Incidental Mutation 'R2067:Gm12695'
ID 226741
Institutional Source Beutler Lab
Gene Symbol Gm12695
Ensembl Gene ENSMUSG00000078639
Gene Name predicted gene 12695
Synonyms
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R2067 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 96723647-96785186 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96769726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 69 (T69A)
Ref Sequence ENSEMBL: ENSMUSP00000102686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107071]
AlphaFold A2AGB2
Predicted Effect probably benign
Transcript: ENSMUST00000107071
AA Change: T69A

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102686
Gene: ENSMUSG00000078639
AA Change: T69A

DomainStartEndE-ValueType
low complexity region 226 237 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Gm12695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Gm12695 APN 4 96749182 missense probably damaging 1.00
IGL01016:Gm12695 APN 4 96757947 missense probably benign 0.03
IGL02605:Gm12695 APN 4 96762751 missense probably null 0.92
IGL02734:Gm12695 APN 4 96724030 nonsense probably null
IGL02869:Gm12695 APN 4 96762133 splice site probably benign
IGL02895:Gm12695 APN 4 96723949 missense probably damaging 0.99
R0020:Gm12695 UTSW 4 96769735 missense probably damaging 0.96
R0465:Gm12695 UTSW 4 96785075 missense probably damaging 1.00
R0941:Gm12695 UTSW 4 96728217 nonsense probably null
R0968:Gm12695 UTSW 4 96762066 missense probably damaging 1.00
R1965:Gm12695 UTSW 4 96762845 missense probably benign 0.16
R1983:Gm12695 UTSW 4 96738977 missense possibly damaging 0.84
R2051:Gm12695 UTSW 4 96769771 missense probably damaging 0.99
R2063:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2064:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2065:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2066:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2073:Gm12695 UTSW 4 96723945 missense possibly damaging 0.76
R2075:Gm12695 UTSW 4 96723945 missense possibly damaging 0.76
R2233:Gm12695 UTSW 4 96724029 missense probably damaging 1.00
R2234:Gm12695 UTSW 4 96724029 missense probably damaging 1.00
R2327:Gm12695 UTSW 4 96769656 missense probably benign 0.00
R2507:Gm12695 UTSW 4 96754189 missense probably damaging 0.99
R3836:Gm12695 UTSW 4 96762097 missense probably damaging 0.99
R4685:Gm12695 UTSW 4 96761980 missense probably damaging 1.00
R5491:Gm12695 UTSW 4 96769668 missense possibly damaging 0.84
R5792:Gm12695 UTSW 4 96728283 missense probably benign 0.00
R6767:Gm12695 UTSW 4 96762696 splice site probably null
R6786:Gm12695 UTSW 4 96762821 missense probably damaging 1.00
R6874:Gm12695 UTSW 4 96785069 missense probably benign 0.04
R6923:Gm12695 UTSW 4 96769816 missense probably benign 0.00
R6978:Gm12695 UTSW 4 96769722 missense possibly damaging 0.69
R7810:Gm12695 UTSW 4 96731371 missense probably damaging 0.99
R8263:Gm12695 UTSW 4 96762809 missense probably benign 0.00
R8272:Gm12695 UTSW 4 96723946 missense possibly damaging 0.76
R8285:Gm12695 UTSW 4 96769753 missense possibly damaging 0.76
R8924:Gm12695 UTSW 4 96762809 missense probably benign 0.00
R9115:Gm12695 UTSW 4 96769609 missense possibly damaging 0.69
Z1177:Gm12695 UTSW 4 96749223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAAATTATGTTCTCCTCTGCAC -3'
(R):5'- TACATCTCACAGGGCTGTTCC -3'

Sequencing Primer
(F):5'- CTGCACTTTTCTAATGAGTTACCAAG -3'
(R):5'- AGGGCTGTTCCTGCTGTTCAC -3'
Posted On 2014-09-17