Incidental Mutation 'R2069:Obsl1'
ID226902
Institutional Source Beutler Lab
Gene Symbol Obsl1
Ensembl Gene ENSMUSG00000026211
Gene Nameobscurin-like 1
Synonyms
MMRRC Submission 040074-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R2069 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75479310-75506452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75486756 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1764 (T1764M)
Ref Sequence ENSEMBL: ENSMUSP00000109197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050899] [ENSMUST00000113567] [ENSMUST00000113575] [ENSMUST00000148980] [ENSMUST00000187411]
Predicted Effect probably benign
Transcript: ENSMUST00000050899
SMART Domains Protein: ENSMUSP00000057865
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
Pfam:DUF4203 40 236 7.2e-51 PFAM
low complexity region 252 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113567
AA Change: T1764M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109197
Gene: ENSMUSG00000026211
AA Change: T1764M

DomainStartEndE-ValueType
IGc2 24 91 1.23e-12 SMART
IGc2 140 216 2.33e-13 SMART
IGc2 258 326 1.48e-6 SMART
IG 347 427 9.49e-5 SMART
IG 435 511 1.04e-1 SMART
FN3 518 601 6.6e-2 SMART
PDB:2E6Q|A 608 714 8e-57 PDB
Blast:IG_like 622 711 3e-50 BLAST
IG 723 804 3.79e-4 SMART
IG 814 893 2.58e-6 SMART
IGc2 911 977 1.12e-6 SMART
IG 996 1075 1.27e-5 SMART
IGc2 1094 1160 4.07e-4 SMART
IGc2 1186 1252 9.49e-5 SMART
IG 1274 1353 7.41e-7 SMART
IG 1363 1444 1.15e-3 SMART
IG 1454 1533 8.33e-1 SMART
IGc2 1549 1615 8.72e-4 SMART
IG 1633 1712 1e-3 SMART
IG 1723 1802 3.82e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113575
SMART Domains Protein: ENSMUSP00000109205
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
Pfam:DUF4203 39 237 2.2e-59 PFAM
low complexity region 252 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132252
SMART Domains Protein: ENSMUSP00000117420
Gene: ENSMUSG00000026211

DomainStartEndE-ValueType
IG_like 1 59 2.8e-1 SMART
IGc2 85 151 9.49e-5 SMART
IG 175 254 2.64e-3 SMART
IG 265 344 7.41e-7 SMART
Blast:IG 354 417 4e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145382
Predicted Effect probably benign
Transcript: ENSMUST00000148980
SMART Domains Protein: ENSMUSP00000116977
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:DUF4203 119 150 6.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154636
Predicted Effect probably benign
Transcript: ENSMUST00000155084
SMART Domains Protein: ENSMUSP00000114553
Gene: ENSMUSG00000026211

DomainStartEndE-ValueType
SCOP:d1g1ca_ 2 32 1e-3 SMART
IGc2 64 132 1.48e-6 SMART
IG 153 233 9.49e-5 SMART
IG 241 317 1.04e-1 SMART
FN3 324 407 6.6e-2 SMART
PDB:2E6Q|A 414 520 4e-57 PDB
Blast:IG_like 428 517 2e-50 BLAST
IG 529 610 3.79e-4 SMART
IG 620 699 2.58e-6 SMART
IGc2 717 783 1.12e-6 SMART
IG 802 881 1.27e-5 SMART
IGc2 900 966 4.07e-4 SMART
IGc2 992 1058 9.49e-5 SMART
IG 1080 1159 7.41e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156705
Predicted Effect probably benign
Transcript: ENSMUST00000187411
SMART Domains Protein: ENSMUSP00000140795
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:DUF4203 101 142 6.9e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (104/104)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,874,280 V86A probably benign Het
Abcc3 A T 11: 94,364,417 I601N probably damaging Het
Abl2 T A 1: 156,620,827 probably null Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ahi1 C T 10: 20,959,996 T76I probably damaging Het
Arhgap42 C T 9: 9,035,600 G247D probably damaging Het
Arid2 C T 15: 96,362,590 L407F probably damaging Het
Atp13a1 T C 8: 69,799,773 F606L probably benign Het
Avl9 T A 6: 56,736,435 probably benign Het
B3glct C T 5: 149,709,380 A65V probably damaging Het
Bcorl1 T C X: 48,401,917 probably benign Het
Bdp1 T C 13: 100,050,988 T1624A probably benign Het
Bmp15 A G X: 6,316,021 M263T probably benign Het
Brd8 T C 18: 34,614,479 K110E probably damaging Het
Cachd1 A G 4: 100,990,844 D1052G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc113 G A 8: 95,557,296 E333K probably benign Het
Ccnl2 A T 4: 155,812,481 probably null Het
Ccr9 T C 9: 123,779,364 F37S probably benign Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Ceacam10 A T 7: 24,778,372 N104I probably damaging Het
Cenpk T A 13: 104,236,176 probably benign Het
Cfi A G 3: 129,858,804 probably null Het
Chd1 T C 17: 15,742,294 F771S probably damaging Het
Chil4 G A 3: 106,219,455 L4F probably benign Het
Cilp G A 9: 65,278,090 R489Q possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Coq8b A G 7: 27,257,377 E485G probably damaging Het
Cse1l A G 2: 166,941,492 S733G probably benign Het
Dnah5 G A 15: 28,312,388 probably null Het
Dnmt3l T C 10: 78,052,732 V156A probably damaging Het
Duox1 A T 2: 122,333,062 T792S probably benign Het
Duox2 T C 2: 122,287,108 D915G probably benign Het
Efcab5 A T 11: 77,172,321 M115K probably benign Het
Eif2s1 G A 12: 78,877,185 D139N probably benign Het
Erg A G 16: 95,361,078 F390L probably damaging Het
Fam193b A T 13: 55,542,998 S650R probably damaging Het
Fbp2 T A 13: 62,854,061 K113N possibly damaging Het
Fnbp4 T G 2: 90,758,372 S496A probably damaging Het
Gab3 C A X: 75,000,095 R475L probably damaging Het
Gm7534 T G 4: 134,201,941 N351T possibly damaging Het
Gsap T C 5: 21,226,839 probably benign Het
Gucy1a2 C T 9: 3,582,697 L160F probably damaging Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Hrasls5 T C 19: 7,612,638 S10P possibly damaging Het
Insc G T 7: 114,804,593 probably null Het
Jph2 A G 2: 163,339,685 S520P possibly damaging Het
Kidins220 T A 12: 24,987,006 probably benign Het
Krtap29-1 A G 11: 99,978,612 S148P probably damaging Het
Ltbp2 A C 12: 84,793,733 C1000G probably damaging Het
Map2k3 T C 11: 60,950,027 F294S probably damaging Het
Map4k2 C A 19: 6,342,738 probably benign Het
Mboat2 T C 12: 24,951,443 V281A probably benign Het
Mdga2 G A 12: 66,568,917 R570* probably null Het
Mlxipl A G 5: 135,107,005 D28G probably damaging Het
Morc2b T C 17: 33,136,760 I679M probably benign Het
Myh4 T C 11: 67,246,366 probably benign Het
Nfib A C 4: 82,498,615 L61R probably damaging Het
Noc2l C A 4: 156,241,450 Y227* probably null Het
Nrde2 A G 12: 100,142,232 S367P probably damaging Het
Nup93 C A 8: 94,243,739 P89T probably damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1283 A G 2: 111,369,095 I154M probably benign Het
Olfr6 A T 7: 106,956,287 Y216* probably null Het
Olfr714 A T 7: 107,074,619 K264* probably null Het
Olfr749 T A 14: 50,736,576 E195D possibly damaging Het
Olfr824 A G 10: 130,126,205 I284T possibly damaging Het
Oxct1 G T 15: 4,092,525 A319S probably null Het
P2ry10 A G X: 107,103,253 S265G probably benign Het
Peak1 A T 9: 56,258,759 N628K probably damaging Het
Pkdrej T A 15: 85,821,231 Q168L probably benign Het
Plec A G 15: 76,188,926 M604T probably benign Het
Pmfbp1 A T 8: 109,532,103 N680I possibly damaging Het
Pnmal2 T C 7: 16,945,789 W233R probably damaging Het
Pxn A G 5: 115,545,667 N186S probably benign Het
Rsad1 A C 11: 94,549,125 probably benign Het
Runx2 A G 17: 44,735,342 I112T probably benign Het
S1pr2 A T 9: 20,967,494 L346Q probably damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Slc36a4 T A 9: 15,726,980 F234Y probably damaging Het
Slitrk2 T A X: 66,654,629 V242D probably damaging Het
Sp100 A G 1: 85,681,142 probably null Het
Spryd3 A C 15: 102,118,181 L352V probably benign Het
Ssc4d A C 5: 135,970,317 W11G possibly damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tlk2 A T 11: 105,240,440 Q204L probably benign Het
Tnfrsf21 A T 17: 43,037,938 H147L possibly damaging Het
Tnrc18 A T 5: 142,766,087 D1154E unknown Het
Trap1 A G 16: 4,068,336 S86P probably benign Het
Trim32 T A 4: 65,614,776 C523* probably null Het
Ttc38 G T 15: 85,838,788 D146Y probably damaging Het
Ttc9 T A 12: 81,631,796 L131Q probably damaging Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttn T C 2: 76,726,848 probably benign Het
Ubash3b G A 9: 41,043,573 P92S possibly damaging Het
Ube4a T C 9: 44,948,099 N367S probably damaging Het
Ubr4 T A 4: 139,479,540 H4899Q possibly damaging Het
Ufl1 C T 4: 25,269,036 G265D possibly damaging Het
Vmn2r27 T A 6: 124,224,483 I172F probably damaging Het
Vmn2r6 A T 3: 64,556,098 H438Q possibly damaging Het
Vmn2r61 A G 7: 42,300,001 D615G probably benign Het
Wdr24 T A 17: 25,826,282 D330E probably damaging Het
Zbbx A T 3: 75,078,412 N444K probably benign Het
Zc3h7b A T 15: 81,792,328 Q757L probably damaging Het
Other mutations in Obsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Obsl1 APN 1 75490874 missense probably benign 0.02
IGL01111:Obsl1 APN 1 75497145 missense possibly damaging 0.62
IGL01140:Obsl1 APN 1 75489756 unclassified probably benign
IGL02149:Obsl1 APN 1 75503820 missense probably damaging 1.00
IGL02225:Obsl1 APN 1 75503798 missense probably damaging 0.99
IGL02269:Obsl1 APN 1 75487713 missense probably damaging 0.97
IGL02296:Obsl1 APN 1 75498149 missense possibly damaging 0.94
IGL02386:Obsl1 APN 1 75492517 missense probably damaging 1.00
IGL02408:Obsl1 APN 1 75505246 missense probably damaging 0.98
IGL02601:Obsl1 APN 1 75489620 missense probably benign
IGL03053:Obsl1 APN 1 75493079 missense probably benign
IGL03181:Obsl1 APN 1 75492584 missense probably benign 0.00
IGL03402:Obsl1 APN 1 75486799 missense probably benign 0.00
PIT1430001:Obsl1 UTSW 1 75506167 missense probably damaging 1.00
PIT4382001:Obsl1 UTSW 1 75487963 missense probably benign 0.06
R0281:Obsl1 UTSW 1 75492927 missense probably damaging 1.00
R1343:Obsl1 UTSW 1 75492579 missense probably damaging 1.00
R1394:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1395:Obsl1 UTSW 1 75492665 missense probably damaging 0.96
R1439:Obsl1 UTSW 1 75486784 nonsense probably null
R1456:Obsl1 UTSW 1 75487656 nonsense probably null
R1728:Obsl1 UTSW 1 75486756 missense probably benign
R1729:Obsl1 UTSW 1 75486756 missense probably benign
R1730:Obsl1 UTSW 1 75486756 missense probably benign
R1739:Obsl1 UTSW 1 75486756 missense probably benign
R1757:Obsl1 UTSW 1 75493883 missense probably benign
R1762:Obsl1 UTSW 1 75486756 missense probably benign
R1783:Obsl1 UTSW 1 75486756 missense probably benign
R1784:Obsl1 UTSW 1 75486756 missense probably benign
R1785:Obsl1 UTSW 1 75486756 missense probably benign
R1851:Obsl1 UTSW 1 75492893 missense probably damaging 1.00
R1864:Obsl1 UTSW 1 75493109 missense probably benign 0.01
R1873:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1875:Obsl1 UTSW 1 75498233 missense probably damaging 1.00
R1980:Obsl1 UTSW 1 75505836 missense probably damaging 1.00
R1985:Obsl1 UTSW 1 75505600 missense probably damaging 1.00
R2049:Obsl1 UTSW 1 75486756 missense probably benign
R2122:Obsl1 UTSW 1 75493883 missense probably benign
R2141:Obsl1 UTSW 1 75486756 missense probably benign
R2142:Obsl1 UTSW 1 75486756 missense probably benign
R2184:Obsl1 UTSW 1 75502217 missense probably benign 0.26
R2267:Obsl1 UTSW 1 75505698 missense probably damaging 1.00
R2883:Obsl1 UTSW 1 75496511 missense possibly damaging 0.73
R3079:Obsl1 UTSW 1 75490823 missense probably damaging 1.00
R3749:Obsl1 UTSW 1 75498246 missense probably benign
R4002:Obsl1 UTSW 1 75500099 missense possibly damaging 0.90
R4365:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4366:Obsl1 UTSW 1 75488049 missense possibly damaging 0.91
R4414:Obsl1 UTSW 1 75490902 missense probably benign 0.00
R4700:Obsl1 UTSW 1 75503441 missense probably damaging 1.00
R4799:Obsl1 UTSW 1 75489501 missense possibly damaging 0.93
R5081:Obsl1 UTSW 1 75487963 missense possibly damaging 0.49
R5389:Obsl1 UTSW 1 75503261 intron probably benign
R5757:Obsl1 UTSW 1 75493055 missense probably damaging 0.98
R5890:Obsl1 UTSW 1 75493859 missense probably damaging 1.00
R5946:Obsl1 UTSW 1 75491207 missense probably damaging 0.96
R6005:Obsl1 UTSW 1 75492215 splice site probably null
R6118:Obsl1 UTSW 1 75492078 intron probably benign
R6154:Obsl1 UTSW 1 75500144 missense probably benign 0.19
R6317:Obsl1 UTSW 1 75489629 missense possibly damaging 0.50
R6379:Obsl1 UTSW 1 75503143 missense probably damaging 1.00
R6387:Obsl1 UTSW 1 75491362 missense probably benign 0.03
R7084:Obsl1 UTSW 1 75487750 missense probably benign
R7123:Obsl1 UTSW 1 75489669 missense probably damaging 1.00
R7202:Obsl1 UTSW 1 75489716 missense possibly damaging 0.94
R7291:Obsl1 UTSW 1 75489517 missense probably damaging 0.98
R7305:Obsl1 UTSW 1 75493946 nonsense probably null
R7366:Obsl1 UTSW 1 75502964 missense probably damaging 1.00
R7402:Obsl1 UTSW 1 75487704 missense probably benign
R7474:Obsl1 UTSW 1 75498184 missense probably benign 0.00
R7611:Obsl1 UTSW 1 75505380 missense probably damaging 0.96
R7672:Obsl1 UTSW 1 75492721 missense probably benign 0.18
R7715:Obsl1 UTSW 1 75502036 missense probably damaging 0.99
R7762:Obsl1 UTSW 1 75503523 missense probably benign
R8005:Obsl1 UTSW 1 75505452 missense probably damaging 1.00
R8012:Obsl1 UTSW 1 75492673 missense probably benign 0.12
R8379:Obsl1 UTSW 1 75503857 missense possibly damaging 0.92
R8381:Obsl1 UTSW 1 75503857 missense possibly damaging 0.92
R8383:Obsl1 UTSW 1 75503857 missense possibly damaging 0.92
R8396:Obsl1 UTSW 1 75503706 missense probably benign 0.01
R8465:Obsl1 UTSW 1 75503388 missense probably damaging 1.00
R8506:Obsl1 UTSW 1 75505656 missense probably benign 0.00
R8710:Obsl1 UTSW 1 75492682 missense probably benign
R8877:Obsl1 UTSW 1 75496523 nonsense probably null
V8831:Obsl1 UTSW 1 75486756 missense probably benign
X0061:Obsl1 UTSW 1 75486768 missense probably benign
Z1088:Obsl1 UTSW 1 75486756 missense probably benign
Z1176:Obsl1 UTSW 1 75486756 missense probably benign
Z1177:Obsl1 UTSW 1 75486756 missense probably benign
Z1177:Obsl1 UTSW 1 75491012 missense possibly damaging 0.95
Z1177:Obsl1 UTSW 1 75503792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAGGTATAGCTCGGCAC -3'
(R):5'- GTGCGTGTCCTTATTAAGCCC -3'

Sequencing Primer
(F):5'- CATAGGTATAGCTCGGCACTGCAG -3'
(R):5'- TATTAAGCCCCTGTCCCCCAAC -3'
Posted On2014-09-17