Incidental Mutation 'R2077:Scaf4'
ID229243
Institutional Source Beutler Lab
Gene Symbol Scaf4
Ensembl Gene ENSMUSG00000022983
Gene NameSR-related CTD-associated factor 4
SynonymsSfrs15, Sra4, Srsf15
MMRRC Submission 040082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R2077 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90225680-90284503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90252435 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 255 (F255I)
Ref Sequence ENSEMBL: ENSMUSP00000156174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039280] [ENSMUST00000163419] [ENSMUST00000232371]
Predicted Effect unknown
Transcript: ENSMUST00000039280
AA Change: F255I
SMART Domains Protein: ENSMUSP00000044472
Gene: ENSMUSG00000022983
AA Change: F255I

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 558 N/A INTRINSIC
RRM 574 643 7.47e-14 SMART
low complexity region 719 757 N/A INTRINSIC
low complexity region 762 829 N/A INTRINSIC
low complexity region 871 886 N/A INTRINSIC
low complexity region 937 980 N/A INTRINSIC
low complexity region 983 997 N/A INTRINSIC
low complexity region 1006 1046 N/A INTRINSIC
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1111 1145 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163419
AA Change: F255I
SMART Domains Protein: ENSMUSP00000132250
Gene: ENSMUSG00000022983
AA Change: F255I

DomainStartEndE-ValueType
RPR 6 136 7.8e-48 SMART
low complexity region 190 214 N/A INTRINSIC
low complexity region 272 313 N/A INTRINSIC
low complexity region 360 389 N/A INTRINSIC
low complexity region 390 418 N/A INTRINSIC
low complexity region 420 448 N/A INTRINSIC
low complexity region 496 554 N/A INTRINSIC
RRM 570 639 7.47e-14 SMART
low complexity region 715 753 N/A INTRINSIC
low complexity region 758 825 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 911 954 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1056 1070 N/A INTRINSIC
low complexity region 1085 1119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231572
Predicted Effect unknown
Transcript: ENSMUST00000232371
AA Change: F255I
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the arginine/serine-rich splicing factor family. A similar protein in Rat appears to bind the large subunit of RNA polymerase II and provide a link between transcription and pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,457,034 probably benign Het
Abhd16b A C 2: 181,493,416 D37A probably benign Het
Acp7 T C 7: 28,629,482 E91G probably damaging Het
Alms1 T A 6: 85,622,309 N1841K possibly damaging Het
Arhgap25 T A 6: 87,460,008 D620V probably damaging Het
Caps2 C T 10: 112,199,727 T371I possibly damaging Het
Ccdc175 A G 12: 72,140,020 I350T possibly damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdc42bpb A G 12: 111,299,196 L1434P probably damaging Het
Cdkl3 A T 11: 52,026,839 E321V probably damaging Het
Clec2d G T 6: 129,183,190 V56L possibly damaging Het
Cops3 A T 11: 59,824,310 S301T possibly damaging Het
Crygd T C 1: 65,063,246 D19G probably damaging Het
Dnah2 T C 11: 69,496,606 I931M possibly damaging Het
Dst A T 1: 34,211,170 R4068S probably damaging Het
Fas C T 19: 34,320,553 probably benign Het
G6pd2 T A 5: 61,810,251 D456E probably damaging Het
Galnt18 G A 7: 111,554,602 R272W probably damaging Het
Grb2 C A 11: 115,645,825 G200W probably damaging Het
Herc4 A G 10: 63,264,053 N85S probably benign Het
Ighv7-2 T C 12: 113,912,107 D92G probably damaging Het
Itih3 A G 14: 30,909,835 V765A possibly damaging Het
Itm2b T C 14: 73,363,120 N247D probably benign Het
Kcnd3 T C 3: 105,666,999 V500A probably benign Het
Lrp2 C T 2: 69,507,843 G1198R probably damaging Het
Ltb4r2 A G 14: 55,761,987 T22A probably damaging Het
Mdga2 A G 12: 66,655,362 V355A probably damaging Het
Megf8 T A 7: 25,353,738 V1778E probably benign Het
Mroh2b G A 15: 4,944,966 E1143K probably damaging Het
Nbn A T 4: 15,979,389 Y458F probably damaging Het
Nlrc3 A G 16: 3,963,992 C534R probably benign Het
Nup155 A G 15: 8,143,026 E832G probably damaging Het
Olfr1131 A G 2: 87,628,829 Y122C probably damaging Het
Plcl2 A G 17: 50,606,829 T289A probably benign Het
Ptprs C T 17: 56,434,990 R7Q probably null Het
Rab3ip A T 10: 116,918,960 D198E possibly damaging Het
Senp6 T C 9: 80,126,155 S475P probably benign Het
Shpk T C 11: 73,203,959 L67P probably damaging Het
Sik3 T A 9: 46,219,503 Y1246N probably damaging Het
Slc44a2 A G 9: 21,353,724 Y686C probably damaging Het
Slc6a19 A G 13: 73,700,566 V23A probably benign Het
Slit3 A T 11: 35,544,748 I169F possibly damaging Het
Stxbp5l A G 16: 37,236,275 V379A possibly damaging Het
Tex2 T C 11: 106,506,864 probably null Het
Tnpo3 A G 6: 29,586,144 V149A possibly damaging Het
Vmn1r158 T A 7: 22,790,390 R131S probably benign Het
Vmn2r24 T A 6: 123,815,399 C562S probably damaging Het
Wipi1 T C 11: 109,577,664 N368S probably benign Het
Zbtb41 T C 1: 139,424,093 S315P probably damaging Het
Other mutations in Scaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Scaf4 APN 16 90247281 missense unknown
IGL00536:Scaf4 APN 16 90257362 missense unknown
IGL01122:Scaf4 APN 16 90248630 missense unknown
IGL02015:Scaf4 APN 16 90258846 missense unknown
IGL02074:Scaf4 APN 16 90242920 missense unknown
IGL02555:Scaf4 APN 16 90250305 missense unknown
IGL02735:Scaf4 APN 16 90245515 missense unknown
FR4304:Scaf4 UTSW 16 90229854 small deletion probably benign
FR4589:Scaf4 UTSW 16 90229854 small deletion probably benign
R0217:Scaf4 UTSW 16 90242682 missense probably damaging 0.99
R0410:Scaf4 UTSW 16 90260170 missense unknown
R0681:Scaf4 UTSW 16 90249694 missense unknown
R1099:Scaf4 UTSW 16 90263098 missense unknown
R1510:Scaf4 UTSW 16 90245394 missense unknown
R1694:Scaf4 UTSW 16 90229857 small deletion probably benign
R2087:Scaf4 UTSW 16 90252425 missense unknown
R2182:Scaf4 UTSW 16 90230140 missense probably benign 0.15
R2698:Scaf4 UTSW 16 90244356 missense unknown
R2925:Scaf4 UTSW 16 90250289 missense unknown
R3025:Scaf4 UTSW 16 90251938 missense unknown
R3236:Scaf4 UTSW 16 90260217 missense unknown
R4207:Scaf4 UTSW 16 90260215 missense unknown
R4584:Scaf4 UTSW 16 90229515 unclassified probably benign
R4735:Scaf4 UTSW 16 90252432 missense unknown
R4835:Scaf4 UTSW 16 90250307 missense unknown
R4969:Scaf4 UTSW 16 90251943 nonsense probably null
R5174:Scaf4 UTSW 16 90247174 missense unknown
R5568:Scaf4 UTSW 16 90229857 small deletion probably benign
R5615:Scaf4 UTSW 16 90251960 missense unknown
R5638:Scaf4 UTSW 16 90244310 missense unknown
R6364:Scaf4 UTSW 16 90260248 nonsense probably null
R6470:Scaf4 UTSW 16 90229638 nonsense probably null
R7049:Scaf4 UTSW 16 90260187 missense unknown
R7198:Scaf4 UTSW 16 90252430 missense unknown
R7446:Scaf4 UTSW 16 90258770 missense unknown
R7501:Scaf4 UTSW 16 90230076 missense unknown
X0013:Scaf4 UTSW 16 90252291 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTCACAATGGGGTCTGTGGAG -3'
(R):5'- ACACTGCTTTCATCATTGGAAAAGG -3'

Sequencing Primer
(F):5'- TCTGTGGAGGAGGGGGAG -3'
(R):5'- CTAACGTGCACTTAGTCAAAATTGCC -3'
Posted On2014-09-17