Mutagenetix > Incidental Mutation

Incidental Mutation 'R2138:Son'

236005

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

040141-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R2138 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91647506-91679221 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91659372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1669 (V1669A)

Ref Sequence

ENSEMBL: ENSMUSP00000122320 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]

AlphaFold

Q9QX47

Predicted Effect

probably benign
Transcript: ENSMUST00000114036
AA Change: V1669A

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: V1669A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.65e-7	PROSPERO
internal_repeat_2	214	362	6.55e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.65e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.55e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114037
AA Change: V1669A

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: V1669A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.71e-7	PROSPERO
internal_repeat_2	214	362	7.05e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.71e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	7.05e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC
G_patch	2321	2367	1.15e-17	SMART
Pfam:DND1_DSRM	2388	2442	5.7e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117633
AA Change: V1669A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: V1669A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.59e-7	PROSPERO
internal_repeat_2	214	362	6.63e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.59e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.63e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
Pfam:RSRP	1909	2216	1e-12	PFAM
G_patch	2321	2367	1.15e-17	SMART
DSRM	2390	2458	5.37e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119368
AA Change: V1669A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: V1669A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.22e-7	PROSPERO
internal_repeat_2	214	362	8.67e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.22e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	8.67e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122302

SMART Domains

Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	159	165	N/A	INTRINSIC
G_patch	331	377	1.15e-17	SMART
Pfam:DND1_DSRM	398	452	7.9e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133589

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140312
AA Change: V1669A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: V1669A

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.93e-7	PROSPERO
internal_repeat_2	214	362	1.1e-5	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.93e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	1.1e-5	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147891

SMART Domains

Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
Pfam:RSRP	61	358	2.9e-13	PFAM
low complexity region	466	477	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aamp	A	G	1: 74,283,963	V6A	probably benign	Het
Abcc6	A	G	7: 45,981,051	F1262L	probably damaging	Het
Acot13	A	T	13: 24,818,205		probably null	Het
Adgrv1	T	C	13: 81,445,320	I4183V	probably benign	Het
Aff4	T	G	11: 53,372,512	S120A	possibly damaging	Het
Afp	A	G	5: 90,499,647	E250G	probably damaging	Het
Ankrd34b	A	T	13: 92,439,406	D382V	probably damaging	Het
Arhgef19	A	T	4: 141,250,800	I577F	probably damaging	Het
Arl6	A	G	16: 59,622,467		probably benign	Het
Atp2b2	A	T	6: 113,796,307	M333K	probably benign	Het
Atp8b3	C	A	10: 80,527,105	A635S	possibly damaging	Het
Baiap2	A	G	11: 119,957,102	T19A	possibly damaging	Het
Bcar3	A	G	3: 122,512,996	D206G	probably damaging	Het
Ccdc162	A	T	10: 41,581,297	M85K	probably benign	Het
Clec4a4	A	G	6: 123,023,978	N217D	probably damaging	Het
Csmd1	T	C	8: 15,929,088	Y2832C	probably damaging	Het
Cubn	A	G	2: 13,444,378	I962T	probably damaging	Het
Dennd4a	A	G	9: 64,889,337	Y852C	probably damaging	Het
Dhcr24	G	T	4: 106,572,302	E191*	probably null	Het
Dusp12	G	A	1: 170,880,597	Q114*	probably null	Het
Elfn2	G	T	15: 78,674,038	T103K	probably benign	Het
Eme1	A	T	11: 94,648,192	V314E	probably damaging	Het
Epb41l3	A	G	17: 69,207,880	E4G	probably damaging	Het
Exoc6b	A	T	6: 84,989,482	L170Q	probably damaging	Het
Fam129a	G	A	1: 151,696,251	V316M	probably damaging	Het
Fbln5	C	T	12: 101,761,920	M261I	probably benign	Het
Fgf22	T	C	10: 79,756,601	V64A	probably damaging	Het
Gak	C	T	5: 108,606,877		probably null	Het
Gatad2b	T	A	3: 90,352,113	S401R	probably damaging	Het
Gen1	A	T	12: 11,241,621	S722R	probably damaging	Het
Gm10754	A	T	10: 97,682,270		probably benign	Het
Gm8897	A	T	5: 11,419,085	R68*	probably null	Het
Grid2	G	A	6: 64,345,798	R594Q	probably damaging	Het
Grm7	C	A	6: 110,646,137	N90K	probably damaging	Het
Herc1	G	A	9: 66,470,307	V3452M	possibly damaging	Het
Il22ra2	T	A	10: 19,632,870	F215L	probably benign	Het
Kank1	G	A	19: 25,411,753	G930D	probably benign	Het
Klra3	A	T	6: 130,333,158	V133D	probably benign	Het
Lims2	A	G	18: 31,955,407	E220G	possibly damaging	Het
Mbd3l2	A	T	9: 18,444,958	D193V	probably damaging	Het
Mbl1	T	A	14: 41,153,691	I34K	possibly damaging	Het
Mgam	C	T	6: 40,756,450	P839S	probably damaging	Het
Mmp9	G	T	2: 164,952,467	E460*	probably null	Het
Mov10	T	C	3: 104,804,242	H316R	probably benign	Het
Ms4a18	A	T	19: 10,997,331	V332D	possibly damaging	Het
Myo15b	T	C	11: 115,883,807	S2082P	probably benign	Het
Myrfl	G	A	10: 116,795,538	T706I	probably benign	Het
Nampt	C	A	12: 32,838,422	H191N	possibly damaging	Het
Nphp3	A	G	9: 104,025,903	E693G	possibly damaging	Het
Obscn	A	T	11: 59,003,665	Y1191*	probably null	Het
Olfr19	A	G	16: 16,673,205	Y259H	probably damaging	Het
Olfr398	A	T	11: 73,984,303	Y102N	probably damaging	Het
Olfr419	A	T	1: 174,250,736		probably null	Het
Osbpl10	A	G	9: 115,232,134	N760S	probably benign	Het
Otof	A	G	5: 30,461,770	V10A	probably benign	Het
Pkhd1l1	A	C	15: 44,501,457	E664A	probably damaging	Het
Pnp2	T	C	14: 50,963,704	S178P	probably damaging	Het
Pvr	G	A	7: 19,917,002	T199I	probably damaging	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rnaseh2b	T	C	14: 62,361,345	V173A	probably benign	Het
Sept12	C	T	16: 4,992,206	R155H	probably damaging	Het
Slco6d1	G	T	1: 98,443,660	R290L	probably benign	Het
Snx32	A	G	19: 5,496,129	V335A	probably damaging	Het
Tbata	C	T	10: 61,179,284	T116I	probably benign	Het
Tdrd1	T	A	19: 56,842,589	S279T	probably benign	Het
Thsd7a	A	T	6: 12,471,073	Y515*	probably null	Het
Tmem102	T	G	11: 69,805,114	L40F	probably damaging	Het
Tmem169	A	G	1: 72,300,996	N195S	probably damaging	Het
Tmem201	A	T	4: 149,718,080	S613T	probably damaging	Het
Tnfaip6	A	T	2: 52,052,332	I218F	possibly damaging	Het
Tube1	C	A	10: 39,147,351	H331Q	probably benign	Het
Wwc1	G	A	11: 35,841,887	T998I	possibly damaging	Het
Xpc	A	T	6: 91,498,122	Y638*	probably null	Het
Zdhhc4	A	T	5: 143,324,262	Y80*	probably null	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91664322	missense	probably damaging	0.99
IGL01024:Son	APN	16	91655910	missense	probably damaging	1.00
IGL01066:Son	APN	16	91660136	intron	probably benign
IGL01083:Son	APN	16	91657391	missense	probably damaging	1.00
IGL01115:Son	APN	16	91659458	missense	probably benign	0.31
IGL01467:Son	APN	16	91657277	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91657286	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91658015	missense	probably benign	0.00
IGL02156:Son	APN	16	91656104	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91658795	missense	probably damaging	0.99
IGL02498:Son	APN	16	91656825	missense	probably damaging	0.99
IGL02517:Son	APN	16	91655211	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91658471	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91651752	missense	probably damaging	1.00
IGL03180:Son	APN	16	91657008	missense	probably damaging	1.00
R0013:Son	UTSW	16	91651662	missense	probably damaging	1.00
R0036:Son	UTSW	16	91660166	intron	probably benign
R0037:Son	UTSW	16	91664728	missense	probably damaging	1.00
R0041:Son	UTSW	16	91659333	missense	probably damaging	1.00
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91678155	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91656873	missense	probably damaging	0.99
R0256:Son	UTSW	16	91656584	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91656144	missense	probably damaging	1.00
R0815:Son	UTSW	16	91655484	missense	probably damaging	0.98
R1225:Son	UTSW	16	91657340	missense	probably damaging	1.00
R1255:Son	UTSW	16	91664695	missense	probably damaging	1.00
R1457:Son	UTSW	16	91657086	missense	probably damaging	1.00
R1459:Son	UTSW	16	91655342	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91659734	missense	probably damaging	0.99
R1587:Son	UTSW	16	91659718	missense	probably damaging	1.00
R1605:Son	UTSW	16	91657664	missense	probably damaging	1.00
R1629:Son	UTSW	16	91657622	missense	probably damaging	1.00
R1711:Son	UTSW	16	91660226	intron	probably benign
R2245:Son	UTSW	16	91647960	splice site	probably null
R2351:Son	UTSW	16	91657659	missense	probably damaging	0.98
R2434:Son	UTSW	16	91654687	missense	probably damaging	1.00
R2870:Son	UTSW	16	91664317	splice site	probably null
R2871:Son	UTSW	16	91664317	splice site	probably null
R2872:Son	UTSW	16	91664317	splice site	probably null
R2889:Son	UTSW	16	91659899	unclassified	probably benign
R3712:Son	UTSW	16	91656726	missense	probably damaging	0.99
R3913:Son	UTSW	16	91660111	intron	probably benign
R4172:Son	UTSW	16	91659362	missense	probably damaging	1.00
R4301:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4302:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91658868	missense	probably damaging	0.96
R4881:Son	UTSW	16	91675509	missense	probably benign	0.31
R5020:Son	UTSW	16	91656375	missense	probably damaging	1.00
R5032:Son	UTSW	16	91657664	missense	probably damaging	1.00
R5151:Son	UTSW	16	91655699	missense	probably damaging	1.00
R5153:Son	UTSW	16	91655022	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91656675	missense	probably damaging	0.99
R5243:Son	UTSW	16	91654733	missense	probably damaging	1.00
R5354:Son	UTSW	16	91655739	missense	probably damaging	0.99
R5529:Son	UTSW	16	91655466	missense	probably damaging	1.00
R5696:Son	UTSW	16	91671413	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91657490	missense	probably damaging	1.00
R5766:Son	UTSW	16	91664987	intron	probably benign
R5788:Son	UTSW	16	91660052	intron	probably benign
R5992:Son	UTSW	16	91658904	missense	probably benign	0.04
R6314:Son	UTSW	16	91660410	intron	probably benign
R6371:Son	UTSW	16	91674741
R6429:Son	UTSW	16	91658166	missense	probably benign	0.33
R6451:Son	UTSW	16	91657602	missense	probably damaging	0.99
R6489:Son	UTSW	16	91655156	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91659947	intron	probably benign
R6753:Son	UTSW	16	91657188	missense	probably damaging	0.99
R6916:Son	UTSW	16	91654785	missense	probably damaging	0.97
R7070:Son	UTSW	16	91656841	unclassified	probably benign
R7079:Son	UTSW	16	91656841	unclassified	probably benign
R7110:Son	UTSW	16	91656518	missense	probably benign	0.01
R7120:Son	UTSW	16	91656691	unclassified	probably benign
R7120:Son	UTSW	16	91670526	missense	unknown
R7167:Son	UTSW	16	91660334	small deletion	probably benign
R7205:Son	UTSW	16	91660295	small deletion	probably benign
R7208:Son	UTSW	16	91662102	missense	unknown
R7219:Son	UTSW	16	91665001	missense	unknown
R7249:Son	UTSW	16	91660334	small deletion	probably benign
R7328:Son	UTSW	16	91658390	missense	probably benign	0.33
R7330:Son	UTSW	16	91656598	unclassified	probably benign
R7374:Son	UTSW	16	91660334	small deletion	probably benign
R7405:Son	UTSW	16	91656691	unclassified	probably benign
R7420:Son	UTSW	16	91660334	small deletion	probably benign
R7424:Son	UTSW	16	91660334	small deletion	probably benign
R7464:Son	UTSW	16	91656691	unclassified	probably benign
R7514:Son	UTSW	16	91654860	missense	probably damaging	0.99
R7555:Son	UTSW	16	91658922	missense	probably damaging	0.99
R7645:Son	UTSW	16	91660295	small deletion	probably benign
R7716:Son	UTSW	16	91656691	unclassified	probably benign
R7718:Son	UTSW	16	91660334	small deletion	probably benign
R7778:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7824:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7856:Son	UTSW	16	91659258	missense	probably damaging	0.99
R7870:Son	UTSW	16	91656598	unclassified	probably benign
R7928:Son	UTSW	16	91656841	unclassified	probably benign
R7972:Son	UTSW	16	91660334	small deletion	probably benign
R7978:Son	UTSW	16	91660334	small deletion	probably benign
R8000:Son	UTSW	16	91660334	small deletion	probably benign
R8192:Son	UTSW	16	91655549	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8227:Son	UTSW	16	91656691	unclassified	probably benign
R8233:Son	UTSW	16	91660334	small deletion	probably benign
R8255:Son	UTSW	16	91664936	missense	unknown
R8292:Son	UTSW	16	91656657	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91660334	small deletion	probably benign
R8468:Son	UTSW	16	91656691	unclassified	probably benign
R8495:Son	UTSW	16	91660295	small deletion	probably benign
R8772:Son	UTSW	16	91657938	missense	possibly damaging	0.65
R8796:Son	UTSW	16	91660334	small deletion	probably benign
R8862:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8962:Son	UTSW	16	91658169	missense	possibly damaging	0.91
R8972:Son	UTSW	16	91660334	small deletion	probably benign
R8991:Son	UTSW	16	91656478	missense	probably benign	0.04
R8991:Son	UTSW	16	91656720	missense	possibly damaging	0.95
R9086:Son	UTSW	16	91670530	missense	unknown
R9138:Son	UTSW	16	91655118	missense	possibly damaging	0.80
R9232:Son	UTSW	16	91656691	unclassified	probably benign
R9241:Son	UTSW	16	91657234	missense	probably damaging	0.96
R9258:Son	UTSW	16	91677682	missense	unknown
R9328:Son	UTSW	16	91655757	missense	possibly damaging	0.67
R9420:Son	UTSW	16	91657620	missense	probably damaging	0.98
R9468:Son	UTSW	16	91657551	missense	possibly damaging	0.53
R9500:Son	UTSW	16	91660334	small deletion	probably benign
R9516:Son	UTSW	16	91656691	unclassified	probably benign
RF007:Son	UTSW	16	91659369	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91656691	unclassified	probably benign
Z1176:Son	UTSW	16	91655801	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AATTGGCTACCTGTGCTGC -3'
(R):5'- TGCTGGCAGAATATCCTGACTC -3'

Sequencing Primer
(F):5'- TACCTGTGCTGCCGTCAG -3'
(R):5'- GACTCAGGAACTATTTCTTTATTGGG -3'

Posted On

2014-10-01