Incidental Mutation 'R0178:Slc27a1'
ID23769
Institutional Source Beutler Lab
Gene Symbol Slc27a1
Ensembl Gene ENSMUSG00000031808
Gene Namesolute carrier family 27 (fatty acid transporter), member 1
SynonymsFatp, FATP1
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0178 (G1)
Quality Score218
Status Validated (trace)
Chromosome8
Chromosomal Location71568882-71587302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71584462 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 417 (Y417H)
Ref Sequence ENSEMBL: ENSMUSP00000148768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034267] [ENSMUST00000212111] [ENSMUST00000212889] [ENSMUST00000213100]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034267
AA Change: Y417H

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034267
Gene: ENSMUSG00000031808
AA Change: Y417H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:AMP-binding 82 515 2.1e-71 PFAM
Pfam:AMP-binding_C 523 598 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211886
Predicted Effect probably benign
Transcript: ENSMUST00000212111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212225
Predicted Effect possibly damaging
Transcript: ENSMUST00000212889
AA Change: Y417H

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000213100
Meta Mutation Damage Score 0.2707 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype PHENOTYPE: Homozygous null mutants are protected from fat-induced insulin resistance and intramuscular accumulation of fatty acid metabolites without alterations in whole body adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Slc27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc27a1 APN 8 71584772 critical splice donor site probably null
IGL02974:Slc27a1 APN 8 71584203 missense probably damaging 0.99
IGL03371:Slc27a1 APN 8 71585408 missense probably benign 0.20
R0508:Slc27a1 UTSW 8 71580228 unclassified probably benign
R0600:Slc27a1 UTSW 8 71584164 missense probably damaging 1.00
R1169:Slc27a1 UTSW 8 71580653 missense probably benign 0.01
R1445:Slc27a1 UTSW 8 71584113 splice site probably null
R1708:Slc27a1 UTSW 8 71584630 splice site probably null
R1737:Slc27a1 UTSW 8 71570860 missense probably benign 0.05
R1850:Slc27a1 UTSW 8 71580703 critical splice donor site probably null
R2419:Slc27a1 UTSW 8 71579916 missense possibly damaging 0.81
R3817:Slc27a1 UTSW 8 71584478 missense probably damaging 1.00
R3967:Slc27a1 UTSW 8 71579787 missense probably damaging 1.00
R4243:Slc27a1 UTSW 8 71584973 missense probably benign 0.00
R4244:Slc27a1 UTSW 8 71584973 missense probably benign 0.00
R4552:Slc27a1 UTSW 8 71580066 splice site probably null
R4649:Slc27a1 UTSW 8 71570764 missense probably benign 0.11
R4748:Slc27a1 UTSW 8 71580675 missense probably damaging 0.97
R4748:Slc27a1 UTSW 8 71580809 missense possibly damaging 0.94
R5273:Slc27a1 UTSW 8 71584256 missense probably benign 0.07
R5913:Slc27a1 UTSW 8 71584263 missense probably benign 0.31
R6958:Slc27a1 UTSW 8 71585439 missense possibly damaging 0.49
R7198:Slc27a1 UTSW 8 71579427 missense possibly damaging 0.94
R7212:Slc27a1 UTSW 8 71584448 missense probably damaging 1.00
R8210:Slc27a1 UTSW 8 71579922 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAATCTGCCGCTACCTGCTG -3'
(R):5'- GAAAACGCTGTGGGCAATCTTCTTG -3'

Sequencing Primer
(F):5'- ACAGATCGGCGAGTTCTAC -3'
(R):5'- gatctggcccacgagaag -3'
Posted On2013-04-16