Mutagenetix > Incidental Mutations

Incidental Mutation 'R0178:Zfc3h1'

60655

Institutional Source

Beutler Lab

Gene Symbol

Zfc3h1

Ensembl Gene

ENSMUSG00000034163

Gene Name

zinc finger, C3H1-type containing

Synonyms

Ccdc131, Psrc2

MMRRC Submission

038446-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R0178 (G1)

Quality Score

154

Status

Validated

Chromosome

Chromosomal Location

115384959-115432772 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 115406725 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000044069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036044]

Predicted Effect

probably benign
Transcript: ENSMUST00000036044

SMART Domains

Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
low complexity region	29	90	N/A	INTRINSIC
low complexity region	120	132	N/A	INTRINSIC
low complexity region	143	214	N/A	INTRINSIC
coiled coil region	361	393	N/A	INTRINSIC
low complexity region	399	432	N/A	INTRINSIC
coiled coil region	436	491	N/A	INTRINSIC
low complexity region	543	556	N/A	INTRINSIC
low complexity region	564	583	N/A	INTRINSIC
low complexity region	595	619	N/A	INTRINSIC
low complexity region	623	636	N/A	INTRINSIC
low complexity region	716	729	N/A	INTRINSIC
low complexity region	752	763	N/A	INTRINSIC
coiled coil region	826	889	N/A	INTRINSIC
coiled coil region	968	1000	N/A	INTRINSIC
low complexity region	1001	1015	N/A	INTRINSIC
Pfam:zf-C3H1	1187	1208	1.3e-11	PFAM
HAT	1384	1416	1.11e0	SMART
HAT	1418	1449	4.35e2	SMART
Blast:HAT	1495	1538	2e-9	BLAST
HAT	1653	1685	3.31e1	SMART
HAT	1762	1797	7.03e1	SMART
HAT	1922	1954	1.29e-1	SMART
low complexity region	1975	1992	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 88.8%

Validation Efficiency

95% (69/73)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	A	G	11: 85,178,438	H94R	probably benign	Het
4922502D21Rik	T	C	6: 129,326,823	R60G	probably benign	Het
4930596D02Rik	T	G	14: 35,811,478	N111T	probably benign	Het
9930021J03Rik	A	G	19: 29,754,788	S342P	probably damaging	Het
Abca1	T	C	4: 53,081,953	D769G	possibly damaging	Het
Adcy6	G	T	15: 98,604,215	Q173K	probably benign	Het
Amotl1	G	A	9: 14,548,773	A890V	probably benign	Het
Arfgap2	C	T	2: 91,267,361	A141V	probably benign	Het
Asb2	G	A	12: 103,325,552	P324L	probably damaging	Het
Cacna1g	G	A	11: 94,463,483	T202I	probably damaging	Het
Capn5	A	G	7: 98,132,891	L214P	probably damaging	Het
Cdh20	A	T	1: 104,975,051	D489V	possibly damaging	Het
Cers5	C	A	15: 99,747,024		probably benign	Het
Chrnb3	T	A	8: 27,393,364	V111D	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cyp2r1	T	C	7: 114,550,408	E248G	probably damaging	Het
Dnmt3b	A	G	2: 153,675,018	T536A	probably benign	Het
Eef2	G	A	10: 81,180,292	V496M	possibly damaging	Het
Fam118a	T	C	15: 85,045,880		probably benign	Het
Fer1l6	T	A	15: 58,637,914		probably null	Het
Fhad1	A	C	4: 141,955,340	F497V	probably benign	Het
Gbe1	G	A	16: 70,478,386	G358D	probably damaging	Het
Gdf10	A	G	14: 33,924,101	D69G	probably damaging	Het
Ggt6	A	G	11: 72,436,818	H150R	possibly damaging	Het
Gm1966	A	T	7: 106,601,821	Y739N	probably damaging	Het
Gm45713	A	T	7: 45,134,458	L110Q	probably damaging	Het
Gm9847	T	C	12: 14,494,648		noncoding transcript	Het
Grwd1	T	C	7: 45,830,630	E51G	probably damaging	Het
H13	A	G	2: 152,681,067	Y100C	probably damaging	Het
Kcne1	A	C	16: 92,348,809	M49R	probably damaging	Het
Kcnma1	C	T	14: 23,526,767	R236H	probably damaging	Het
Knl1	T	A	2: 119,058,405		probably benign	Het
Krt40	T	C	11: 99,541,739	I150M	probably damaging	Het
Ldb2	A	T	5: 44,473,499	V300E	probably damaging	Het
Lrp1b	A	T	2: 40,725,907	C3606S	probably damaging	Het
Lrrc42	A	G	4: 107,247,720	I16T	probably damaging	Het
Lrrc6	A	C	15: 66,454,101	D208E	probably benign	Het
Mtus1	G	T	8: 41,002,361	L87I	possibly damaging	Het
Myot	T	C	18: 44,336,986	F10S	probably damaging	Het
Nrg3	A	T	14: 38,376,456	H480Q	probably damaging	Het
Olfr205	A	T	16: 59,329,420	F30I	probably damaging	Het
Olfr691	G	A	7: 105,336,922	R265C	probably benign	Het
Prl2c5	A	T	13: 13,191,805	D220V	probably damaging	Het
Rbm17	G	A	2: 11,587,779	S295L	probably benign	Het
Serpina6	A	G	12: 103,646,913	I376T	probably damaging	Het
Sh2d2a	A	T	3: 87,849,423	T192S	probably benign	Het
Slc27a1	T	C	8: 71,584,462	Y417H	possibly damaging	Het
Slc6a1	T	G	6: 114,304,852	I32S	possibly damaging	Het
Sntb1	T	C	15: 55,906,144	T150A	probably damaging	Het
Tanc1	T	A	2: 59,835,447	C1183*	probably null	Het
Tmprss7	C	A	16: 45,690,843	W57C	probably damaging	Het
Ubac1	A	T	2: 26,021,428	V36E	possibly damaging	Het
Zfp644	C	T	5: 106,636,905	C592Y	probably damaging	Het

Other mutations in Zfc3h1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00698:Zfc3h1	APN	10	115419832	missense	possibly damaging	0.92
IGL00793:Zfc3h1	APN	10	115416874	missense	probably benign	0.00
IGL01349:Zfc3h1	APN	10	115423448	missense	probably damaging	1.00
IGL01431:Zfc3h1	APN	10	115423223	missense	possibly damaging	0.49
IGL02273:Zfc3h1	APN	10	115427099	missense	probably benign
IGL02382:Zfc3h1	APN	10	115416876	nonsense	probably null
IGL02397:Zfc3h1	APN	10	115407985	missense	probably damaging	1.00
IGL02657:Zfc3h1	APN	10	115411954	missense	possibly damaging	0.48
IGL02826:Zfc3h1	APN	10	115400904	missense	probably benign	0.42
Gnatcatcher	UTSW	10	115400742	missense	probably benign	0.39
hutton	UTSW	10	115415248	missense	probably damaging	0.96
vireo	UTSW	10	115419901	missense	probably benign	0.01
warbler	UTSW	10	115406483	missense	probably damaging	1.00
PIT4260001:Zfc3h1	UTSW	10	115390889	missense	probably damaging	0.99
PIT4354001:Zfc3h1	UTSW	10	115427039	nonsense	probably null
R0062:Zfc3h1	UTSW	10	115416753	missense	probably benign	0.00
R0062:Zfc3h1	UTSW	10	115416753	missense	probably benign	0.00
R0067:Zfc3h1	UTSW	10	115423474	missense	possibly damaging	0.88
R0067:Zfc3h1	UTSW	10	115423474	missense	possibly damaging	0.88
R0104:Zfc3h1	UTSW	10	115415287	missense	possibly damaging	0.66
R0355:Zfc3h1	UTSW	10	115409113	missense	possibly damaging	0.80
R0619:Zfc3h1	UTSW	10	115420810	missense	possibly damaging	0.92
R0731:Zfc3h1	UTSW	10	115410632	missense	probably benign	0.00
R0828:Zfc3h1	UTSW	10	115401707	missense	possibly damaging	0.68
R0866:Zfc3h1	UTSW	10	115427716	missense	probably benign	0.00
R1196:Zfc3h1	UTSW	10	115411961	missense	probably damaging	0.99
R1455:Zfc3h1	UTSW	10	115412108	missense	probably benign	0.11
R1515:Zfc3h1	UTSW	10	115416742	missense	probably benign	0.29
R1617:Zfc3h1	UTSW	10	115390922	missense	probably benign	0.01
R1640:Zfc3h1	UTSW	10	115406901	splice site	probably null
R1959:Zfc3h1	UTSW	10	115423253	missense	probably benign	0.34
R2039:Zfc3h1	UTSW	10	115406483	missense	probably damaging	1.00
R3430:Zfc3h1	UTSW	10	115410523	splice site	probably benign
R3691:Zfc3h1	UTSW	10	115420690	missense	probably benign
R3909:Zfc3h1	UTSW	10	115419901	missense	probably benign	0.01
R4235:Zfc3h1	UTSW	10	115418799	missense	probably benign	0.32
R4684:Zfc3h1	UTSW	10	115423385	missense	probably benign	0.03
R4816:Zfc3h1	UTSW	10	115415694	missense	probably benign	0.16
R4881:Zfc3h1	UTSW	10	115400742	missense	probably benign	0.39
R4883:Zfc3h1	UTSW	10	115410642	missense	probably damaging	1.00
R5038:Zfc3h1	UTSW	10	115404211	missense	probably benign	0.16
R5068:Zfc3h1	UTSW	10	115418783	nonsense	probably null
R5069:Zfc3h1	UTSW	10	115418783	nonsense	probably null
R5070:Zfc3h1	UTSW	10	115418783	nonsense	probably null
R5155:Zfc3h1	UTSW	10	115412121	missense	possibly damaging	0.64
R5190:Zfc3h1	UTSW	10	115418692	missense	probably damaging	1.00
R5499:Zfc3h1	UTSW	10	115410693	missense	probably damaging	1.00
R5932:Zfc3h1	UTSW	10	115400910	missense	probably benign	0.44
R5935:Zfc3h1	UTSW	10	115431357	intron	probably benign
R6165:Zfc3h1	UTSW	10	115420669	missense	probably benign	0.30
R6182:Zfc3h1	UTSW	10	115390859	missense	probably benign	0.00
R6262:Zfc3h1	UTSW	10	115413976	missense	probably damaging	1.00
R6382:Zfc3h1	UTSW	10	115407908	missense	probably benign	0.06
R6392:Zfc3h1	UTSW	10	115401748	missense	probably damaging	1.00
R6539:Zfc3h1	UTSW	10	115412002	missense	probably benign	0.26
R6723:Zfc3h1	UTSW	10	115420733	missense	probably benign	0.34
R7339:Zfc3h1	UTSW	10	115403300	missense	probably damaging	1.00
R7381:Zfc3h1	UTSW	10	115424630	missense	probably benign
R7404:Zfc3h1	UTSW	10	115415248	missense	probably damaging	0.96
R7667:Zfc3h1	UTSW	10	115410701	nonsense	probably null
R7748:Zfc3h1	UTSW	10	115400815	missense	probably benign	0.27
R7910:Zfc3h1	UTSW	10	115420683	nonsense	probably null
R7914:Zfc3h1	UTSW	10	115403157	splice site	probably null
R8023:Zfc3h1	UTSW	10	115420648	missense	probably damaging	1.00
R8169:Zfc3h1	UTSW	10	115418711	missense	probably damaging	0.98
R8358:Zfc3h1	UTSW	10	115404293	missense	probably benign	0.13
Z1176:Zfc3h1	UTSW	10	115408002	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTGTGCCATCTTTGAACCAACC -3'
(R):5'- CGAGATCACAGTTCGTGGAAGACG -3'

Sequencing Primer
(F):5'- TGCTCCTTCGAGAAGAACTG -3'
(R):5'- GAAGACGAGGTCCTCTGTG -3'

Posted On

2013-07-24