Incidental Mutation 'R2197:Olfr1263'
ID238396
Institutional Source Beutler Lab
Gene Symbol Olfr1263
Ensembl Gene ENSMUSG00000059112
Gene Nameolfactory receptor 1263
SynonymsMOR234-2, GA_x6K02T2Q125-51447049-51447969
MMRRC Submission 040199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2197 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90012131-90018424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90015424 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 165 (G165S)
Ref Sequence ENSEMBL: ENSMUSP00000150959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111507] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
Predicted Effect probably damaging
Transcript: ENSMUST00000111507
AA Change: G165S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107132
Gene: ENSMUSG00000059112
AA Change: G165S

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 7.6e-42 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.7e-5 PFAM
Pfam:7tm_1 36 282 2.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214382
AA Change: G165S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000216616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216764
Predicted Effect probably damaging
Transcript: ENSMUST00000217065
AA Change: G165S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A T 11: 102,769,924 I94F possibly damaging Het
Ankrd50 A T 3: 38,455,592 D875E probably damaging Het
Arf3 T C 15: 98,741,404 N60S probably benign Het
Atxn2 T G 5: 121,806,217 probably null Het
B3gnt8 A T 7: 25,628,948 I268F probably benign Het
Bmp1 T A 14: 70,486,272 D708V possibly damaging Het
C1s2 A G 6: 124,632,110 S163P probably damaging Het
C3 A G 17: 57,219,623 I786T probably benign Het
Cacna2d2 T A 9: 107,527,403 L1138Q probably damaging Het
Cage1 T A 13: 38,023,053 Y272F probably damaging Het
Cd300ld A T 11: 114,984,232 M192K possibly damaging Het
Cdc5l A T 17: 45,407,819 F624I probably benign Het
Cdh8 T A 8: 99,196,265 Q333L probably damaging Het
Ciapin1 T A 8: 94,829,159 K128* probably null Het
Col6a3 T A 1: 90,803,745 E988D probably benign Het
Crip3 A G 17: 46,429,412 E46G probably damaging Het
D5Ertd579e A G 5: 36,614,793 S753P possibly damaging Het
Dock6 T A 9: 21,832,881 D126V probably damaging Het
Dvl3 A G 16: 20,523,756 E153G probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Exoc8 A G 8: 124,895,738 L630P probably damaging Het
Fam227a G A 15: 79,623,467 T454M probably damaging Het
Flnc A T 6: 29,459,135 D2472V probably damaging Het
Galnt4 G A 10: 99,108,647 G78E probably damaging Het
Ghr A T 15: 3,333,474 L172* probably null Het
Gjb5 A T 4: 127,356,270 probably null Het
Gm4981 T A 10: 58,236,336 I19F possibly damaging Het
Hdac5 T C 11: 102,204,514 D427G probably damaging Het
Hsd17b4 G A 18: 50,183,302 probably null Het
Kcnab1 T C 3: 65,109,947 I59T probably benign Het
Kcnh7 A G 2: 62,777,606 Y544H probably damaging Het
Kdm7a A G 6: 39,146,936 S765P probably damaging Het
Lama1 A T 17: 67,752,941 H675L probably benign Het
Lemd3 CCCTCCTCCTCCTCCTCCTCC CCCTCCTCCTCCTCCTCC 10: 120,978,527 probably benign Het
Llgl1 T C 11: 60,710,039 S654P possibly damaging Het
Lvrn G T 18: 46,878,342 M455I probably benign Het
Mfsd12 T A 10: 81,357,734 L46Q probably damaging Het
Mtcl1 A T 17: 66,366,432 M783K probably benign Het
Mthfd1l A T 10: 4,028,399 T420S probably damaging Het
Mybphl T A 3: 108,377,319 I294N probably damaging Het
Olfr1307 T C 2: 111,945,313 T48A possibly damaging Het
Olfr598 T A 7: 103,328,624 L46* probably null Het
Oxa1l A T 14: 54,361,467 Q70L probably benign Het
Pcdhac2 A T 18: 37,146,132 I722F probably damaging Het
Pde4d A G 13: 109,948,390 D460G probably damaging Het
Pth1r CGGG CGGGGGG 9: 110,726,990 probably benign Het
Rab11fip3 A G 17: 26,068,178 S334P probably benign Het
Ror2 C T 13: 53,285,780 probably null Het
Scnn1g G C 7: 121,767,296 W572S probably damaging Het
Skint5 G A 4: 113,940,849 S179L probably damaging Het
Slc22a2 G T 17: 12,599,062 G175V probably damaging Het
Spaca6 G A 17: 17,836,154 probably null Het
Tbc1d30 C T 10: 121,304,407 R207H probably damaging Het
Tdrd5 A G 1: 156,259,865 I829T probably benign Het
Tmcc3 T C 10: 94,578,918 S161P probably damaging Het
Tmem150b A G 7: 4,716,354 V189A probably benign Het
Tmem248 A G 5: 130,231,756 D54G probably benign Het
Trmt1 T A 8: 84,690,858 S121T probably damaging Het
Tyk2 C T 9: 21,115,207 V698M probably damaging Het
Usp17la A G 7: 104,860,712 R175G probably damaging Het
Vav1 A G 17: 57,303,140 N464S probably benign Het
Vmn2r57 T G 7: 41,428,825 probably null Het
Vmn2r78 A G 7: 86,921,327 Y351C probably damaging Het
Other mutations in Olfr1263
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Olfr1263 APN 2 90015719 missense probably damaging 1.00
IGL01512:Olfr1263 APN 2 90015292 missense probably damaging 1.00
IGL01722:Olfr1263 APN 2 90015007 missense probably benign 0.39
IGL01787:Olfr1263 APN 2 90015311 missense probably damaging 1.00
IGL02376:Olfr1263 APN 2 90015460 missense probably benign 0.00
IGL03408:Olfr1263 APN 2 90015571 missense probably benign 0.35
R0367:Olfr1263 UTSW 2 90015772 missense probably damaging 0.99
R0765:Olfr1263 UTSW 2 90015670 missense probably benign 0.01
R1158:Olfr1263 UTSW 2 90015254 missense possibly damaging 0.94
R1705:Olfr1263 UTSW 2 90015511 missense possibly damaging 0.90
R1794:Olfr1263 UTSW 2 90015020 missense probably damaging 1.00
R2347:Olfr1263 UTSW 2 90015614 missense possibly damaging 0.82
R2442:Olfr1263 UTSW 2 90015341 missense probably benign
R3160:Olfr1263 UTSW 2 90015021 nonsense probably null
R3162:Olfr1263 UTSW 2 90015021 nonsense probably null
R4298:Olfr1263 UTSW 2 90015649 missense probably benign 0.13
R4898:Olfr1263 UTSW 2 90015418 missense probably damaging 1.00
R5340:Olfr1263 UTSW 2 90015362 missense probably benign
R6280:Olfr1263 UTSW 2 90015049 missense possibly damaging 0.62
R6367:Olfr1263 UTSW 2 90015016 missense probably benign 0.00
R6556:Olfr1263 UTSW 2 90015094 missense probably damaging 1.00
R7086:Olfr1263 UTSW 2 90015250 missense probably benign 0.07
R7502:Olfr1263 UTSW 2 90015011 missense probably benign 0.15
R7585:Olfr1263 UTSW 2 90015049 missense probably damaging 0.99
R8062:Olfr1263 UTSW 2 90015736 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAATGGCTGCATGACTCAG -3'
(R):5'- TGATTTCTCAGGGAGCGAAG -3'

Sequencing Primer
(F):5'- GCTGCATGACTCAGCTTTTTG -3'
(R):5'- TTTCTCAGGGAGCGAAGAATGACC -3'
Posted On2014-10-02