Mutagenetix > Incidental Mutations

Incidental Mutation 'R2265:Spg11'

244047

Institutional Source

Beutler Lab

Gene Symbol

Spg11

Ensembl Gene

ENSMUSG00000033396

Gene Name

SPG11, spatacsin vesicle trafficking associated

Synonyms

C530005A01Rik, 6030465E24Rik

MMRRC Submission

040265-MU

Accession Numbers

Genbank: NM_145531

Is this an essential gene?

Possibly non essential (E-score: 0.283) question?

Stock #

R2265 (G1)

Quality Score

207

Status

Not validated

Chromosome

Chromosomal Location

122053520-122118386 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122108307 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 389 (C389S)

Ref Sequence

ENSEMBL: ENSMUSP00000037543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036450]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036450
AA Change: C389S

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: C389S

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	254	276	N/A	INTRINSIC
low complexity region	945	958	N/A	INTRINSIC
low complexity region	1250	1264	N/A	INTRINSIC
low complexity region	1305	1313	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
low complexity region	1772	1784	N/A	INTRINSIC
Pfam:Spatacsin_C	2082	2374	1.1e-105	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133145

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135847

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578C19Rik	A	G	X: 18,423,687	S179P	possibly damaging	Het
A830018L16Rik	T	C	1: 11,972,104		probably null	Het
Aadac	T	A	3: 60,037,316	D136E	probably damaging	Het
Abca16	A	G	7: 120,431,160	D165G	probably benign	Het
Adam24	T	A	8: 40,680,071	S193T	possibly damaging	Het
Adra2b	T	C	2: 127,363,871	S103P	probably damaging	Het
Agrn	C	T	4: 156,179,218	G173R	probably damaging	Het
Alg11	T	A	8: 22,065,614	V255E	probably benign	Het
Aox1	C	A	1: 58,081,520	D857E	probably damaging	Het
Apob	T	C	12: 8,015,475	F4115S	possibly damaging	Het
Bdkrb2	A	G	12: 105,592,225	T242A	probably benign	Het
Cdca7	T	C	2: 72,482,490	L190P	probably benign	Het
Cenpe	A	G	3: 135,261,636	T2180A	probably benign	Het
Cep41	T	A	6: 30,660,916	I126F	possibly damaging	Het
Col16a1	C	A	4: 130,052,918	H111Q	probably benign	Het
Cops3	T	C	11: 59,827,890	T193A	probably benign	Het
Dbr1	G	A	9: 99,579,410	V153M	probably damaging	Het
Ddx4	A	G	13: 112,621,276	Y290H	probably benign	Het
Dgkb	T	A	12: 38,190,108	S461R	possibly damaging	Het
Dnajc28	T	C	16: 91,616,312	N372S	probably benign	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Dock3	C	A	9: 106,941,326	V1190F	probably damaging	Het
Exosc1	A	G	19: 41,931,418	S54P	probably damaging	Het
Fbxw22	C	T	9: 109,383,994	R295K	probably benign	Het
Foxo1	T	C	3: 52,345,912	S499P	probably benign	Het
Heatr5a	T	C	12: 51,893,745	D1444G	possibly damaging	Het
Hspa2	T	G	12: 76,406,188	I552S	probably benign	Het
Imp4	T	A	1: 34,443,847	I173N	probably damaging	Het
Itgal	A	G	7: 127,306,701	I352V	possibly damaging	Het
Kcnh6	G	A	11: 106,033,817	R816Q	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Kcnip3	G	T	2: 127,465,061	A173D	probably benign	Het
Kir3dl1	A	G	X: 136,525,035	R53G	probably benign	Het
Klhl31	A	G	9: 77,650,158	D52G	possibly damaging	Het
Klk1b21	T	C	7: 44,104,439	I49T	possibly damaging	Het
Lama2	T	A	10: 26,992,936	I2838F	probably damaging	Het
Lilrb4a	T	A	10: 51,491,537	Y58*	probably null	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Mpdz	A	G	4: 81,383,391	S266P	probably damaging	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Mroh7	T	C	4: 106,720,927	N185D	probably benign	Het
Mybphl	A	G	3: 108,365,001	E2G	probably damaging	Het
Mycbp2	T	C	14: 103,262,749	D937G	probably benign	Het
Myo18b	A	G	5: 112,782,673	M1799T	probably damaging	Het
Nr4a2	T	A	2: 57,112,006	D145V	possibly damaging	Het
Ntmt1	C	A	2: 30,820,460	N58K	probably benign	Het
Olfr1066	T	C	2: 86,456,214	Y19C	possibly damaging	Het
Olfr1278	A	G	2: 111,293,179	T304A	probably benign	Het
Olfr1330	A	T	4: 118,893,874	R264W	probably damaging	Het
Olfr164	A	G	16: 19,286,555	Y63H	probably damaging	Het
Olfr583	G	A	7: 103,052,137	V280I	probably benign	Het
Olfr659	T	C	7: 104,670,860	F53L	probably benign	Het
Ovch2	A	T	7: 107,784,575	M521K	probably damaging	Het
P2ry13	T	C	3: 59,210,028	M110V	probably damaging	Het
P2ry14	T	C	3: 59,115,571	N165S	probably damaging	Het
Pcdhb19	A	T	18: 37,497,683	H177L	probably damaging	Het
Phf8	T	C	X: 151,572,601	L520S	possibly damaging	Het
Pjvk	T	G	2: 76,657,453	S230A	possibly damaging	Het
Plch2	T	C	4: 154,993,004	E423G	probably benign	Het
Rad9b	T	C	5: 122,351,342	Y41C	probably damaging	Het
Ranbp3l	A	T	15: 9,057,113	I286F	probably damaging	Het
Rtel1	T	A	2: 181,354,368	V739D	probably damaging	Het
Slc35a3	T	C	3: 116,673,636	K325E	possibly damaging	Het
Spag17	C	A	3: 100,061,866		probably null	Het
Srsf4	T	C	4: 131,897,682	V130A	probably damaging	Het
Taar8b	T	C	10: 24,091,372	N308S	probably damaging	Het
Tas2r117	T	A	6: 132,803,225	C109S	probably benign	Het
Tlr5	T	A	1: 182,975,035	S635T	possibly damaging	Het
Ttc21a	G	T	9: 119,959,008	C833F	possibly damaging	Het
Vash2	T	C	1: 190,950,213	N347D	probably damaging	Het
Vcp	G	A	4: 42,980,833	A759V	possibly damaging	Het
Vmn2r18	T	C	5: 151,586,662	E82G	probably damaging	Het
Vps13c	T	C	9: 67,920,947	V1461A	possibly damaging	Het
Zfp616	T	C	11: 74,085,463	Y853H	possibly damaging	Het

Other mutations in Spg11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Spg11	APN	2	122065560	missense	probably damaging	0.96
IGL00495:Spg11	APN	2	122094456	critical splice donor site	probably null
IGL00757:Spg11	APN	2	122070959	missense	probably benign	0.05
IGL01304:Spg11	APN	2	122072290	missense	probably damaging	1.00
IGL01355:Spg11	APN	2	122113156	missense	probably benign
IGL01626:Spg11	APN	2	122060971	missense	probably damaging	0.98
IGL01739:Spg11	APN	2	122114671	missense	probably damaging	1.00
IGL01835:Spg11	APN	2	122088224	missense	probably benign	0.36
IGL02129:Spg11	APN	2	122095686	missense	probably damaging	0.99
IGL02178:Spg11	APN	2	122097302	missense	probably damaging	1.00
IGL02199:Spg11	APN	2	122059553	missense	probably damaging	1.00
IGL02212:Spg11	APN	2	122108157	missense	probably benign	0.31
IGL02605:Spg11	APN	2	122092260	missense	probably benign	0.00
IGL02635:Spg11	APN	2	122113068	missense	possibly damaging	0.52
IGL02743:Spg11	APN	2	122059507	missense	probably damaging	0.97
IGL02822:Spg11	APN	2	122074534	missense	probably damaging	0.99
IGL02992:Spg11	APN	2	122058398	missense	probably damaging	1.00
IGL03010:Spg11	APN	2	122088320	missense	probably damaging	0.96
3-1:Spg11	UTSW	2	122086890	missense	probably damaging	0.98
PIT4354001:Spg11	UTSW	2	122088185	missense	probably damaging	0.98
R0131:Spg11	UTSW	2	122070968	missense	probably damaging	1.00
R0206:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0208:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0302:Spg11	UTSW	2	122092187	missense	possibly damaging	0.90
R0347:Spg11	UTSW	2	122097369	missense	probably damaging	0.99
R0357:Spg11	UTSW	2	122066232	splice site	probably benign
R0372:Spg11	UTSW	2	122059447	frame shift	probably null
R0715:Spg11	UTSW	2	122084983	missense	probably benign	0.03
R0927:Spg11	UTSW	2	122094487	missense	probably damaging	0.99
R1163:Spg11	UTSW	2	122070941	missense	probably damaging	1.00
R1534:Spg11	UTSW	2	122092325	missense	probably damaging	1.00
R1555:Spg11	UTSW	2	122097377	missense	probably damaging	0.99
R1569:Spg11	UTSW	2	122101706	missense	probably damaging	0.99
R1840:Spg11	UTSW	2	122101756	missense	probably damaging	1.00
R1929:Spg11	UTSW	2	122060207	missense	probably damaging	1.00
R2303:Spg11	UTSW	2	122068837	missense	probably damaging	0.99
R2510:Spg11	UTSW	2	122075310	missense	probably benign	0.03
R2760:Spg11	UTSW	2	122097359	missense	probably damaging	0.99
R2918:Spg11	UTSW	2	122075301	missense	probably damaging	0.99
R3195:Spg11	UTSW	2	122083398	critical splice donor site	probably null
R3423:Spg11	UTSW	2	122071053	missense	probably benign	0.00
R4353:Spg11	UTSW	2	122113194	missense	possibly damaging	0.92
R4407:Spg11	UTSW	2	122075332	missense	probably benign	0.00
R4644:Spg11	UTSW	2	122061029	missense	probably benign	0.03
R4663:Spg11	UTSW	2	122098099	critical splice donor site	probably null
R4684:Spg11	UTSW	2	122065076	missense	probably damaging	1.00
R4771:Spg11	UTSW	2	122065482	nonsense	probably null
R4810:Spg11	UTSW	2	122059796	missense	probably damaging	1.00
R4829:Spg11	UTSW	2	122108455	missense	probably benign	0.44
R5089:Spg11	UTSW	2	122114717	nonsense	probably null
R5362:Spg11	UTSW	2	122061000	missense	probably damaging	0.99
R5684:Spg11	UTSW	2	122093503	missense	probably damaging	1.00
R5899:Spg11	UTSW	2	122098199	missense	possibly damaging	0.67
R5923:Spg11	UTSW	2	122093478	missense	probably damaging	0.98
R6052:Spg11	UTSW	2	122097356	missense	probably damaging	0.99
R6111:Spg11	UTSW	2	122093482	missense	probably damaging	0.98
R6174:Spg11	UTSW	2	122086805	intron	probably null
R6226:Spg11	UTSW	2	122088262	missense	possibly damaging	0.69
R6336:Spg11	UTSW	2	122112959	unclassified	probably null
R6480:Spg11	UTSW	2	122092305	missense	probably benign	0.03
R6494:Spg11	UTSW	2	122113225	missense	probably damaging	0.98
R6582:Spg11	UTSW	2	122092292	missense	probably damaging	0.99
R6714:Spg11	UTSW	2	122095731	missense	probably damaging	0.99
R6791:Spg11	UTSW	2	122093443	missense	probably damaging	0.99
R6836:Spg11	UTSW	2	122059535	missense	probably damaging	1.00
R6928:Spg11	UTSW	2	122069904	missense	probably benign	0.37
R7179:Spg11	UTSW	2	122101789	splice site	probably null
R7229:Spg11	UTSW	2	122108104	missense	probably damaging	0.98
R7337:Spg11	UTSW	2	122084993	missense	probably benign	0.09
R7338:Spg11	UTSW	2	122055377	missense	probably damaging	1.00
R7351:Spg11	UTSW	2	122069931	missense	possibly damaging	0.95
R7378:Spg11	UTSW	2	122058429	missense	probably damaging	1.00
R7448:Spg11	UTSW	2	122093545	critical splice acceptor site	probably null
R7505:Spg11	UTSW	2	122075351	nonsense	probably null
R7665:Spg11	UTSW	2	122066267	missense	probably damaging	0.99
R7685:Spg11	UTSW	2	122068880	missense	probably damaging	0.99
R7779:Spg11	UTSW	2	122070939	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACACTGCATGCTCTGGGTC -3'
(R):5'- AATGGGTGCTAAGTGCTGCC -3'

Sequencing Primer
(F):5'- TGCATGCTCTGGGTCTCCAAG -3'
(R):5'- GTGCTAAGTGCTGCCCTGTC -3'

Posted On

2014-10-16