Mutagenetix > Incidental Mutation

Incidental Mutation 'R8810:Spg11'

672324

Institutional Source

Beutler Lab

Gene Symbol

Spg11

Ensembl Gene

ENSMUSG00000033396

Gene Name

SPG11, spatacsin vesicle trafficking associated

Synonyms

C530005A01Rik, 6030465E24Rik

MMRRC Submission

Accession Numbers

Genbank: NM_145531

Essential gene?

Probably non essential (E-score: 0.227) question?

Stock #

R8810 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122053520-122118386 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 122070944 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1505 (D1505A)

Ref Sequence

ENSEMBL: ENSMUSP00000037543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036450]

AlphaFold

Q3UHA3

Predicted Effect

probably damaging
Transcript: ENSMUST00000036450
AA Change: D1505A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: D1505A

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	254	276	N/A	INTRINSIC
low complexity region	945	958	N/A	INTRINSIC
low complexity region	1250	1264	N/A	INTRINSIC
low complexity region	1305	1313	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
low complexity region	1772	1784	N/A	INTRINSIC
Pfam:Spatacsin_C	2082	2374	1.1e-105	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,704	S1408P	probably damaging	Het
Acap3	T	C	4: 155,905,712	V783A	probably damaging	Het
Akap8	T	C	17: 32,306,530	N525S	probably damaging	Het
Aqp1	C	T	6: 55,336,621	T44M	probably damaging	Het
Arap1	T	C	7: 101,404,378	Y1305H	probably damaging	Het
Atg2a	T	G	19: 6,250,621	S743A	probably benign	Het
AW551984	G	T	9: 39,600,011	L133I	probably damaging	Het
Bahcc1	C	A	11: 120,273,761	P802T	possibly damaging	Het
Brd8	C	A	18: 34,609,949	V288L	probably benign	Het
Carmil2	T	C	8: 105,686,315		probably null	Het
Catspere2	G	A	1: 178,077,482	E153K	possibly damaging	Het
Ccdc162	C	T	10: 41,666,741	R379Q	probably benign	Het
Cdh16	A	G	8: 104,614,504	L116P	probably damaging	Het
Cenpj	A	T	14: 56,558,619	H260Q	possibly damaging	Het
Cenpq	A	G	17: 40,933,136	V17A	possibly damaging	Het
Cep350	T	C	1: 155,928,116	K1074E	probably damaging	Het
Chil4	C	A	3: 106,201,805	C394F	probably damaging	Het
Chst9	T	C	18: 15,717,926	I28V	probably benign	Het
Clasp2	C	A	9: 113,899,581	N873K	probably damaging	Het
Clec4b2	T	A	6: 123,181,310	M45K	probably benign	Het
Cmya5	T	A	13: 93,063,540	T3427S	possibly damaging	Het
Cnih4	A	G	1: 181,162,212	Y130C	probably damaging	Het
Cpne9	T	A	6: 113,304,545	M529K	probably damaging	Het
Ctsr	T	A	13: 61,161,825	Y190F	probably damaging	Het
Cyp2j13	G	A	4: 96,056,916	H351Y	probably benign	Het
Dixdc1	T	A	9: 50,701,965	Q230L	probably damaging	Het
Dpep1	A	T	8: 123,200,025	I226F	probably benign	Het
Ehd2	A	G	7: 15,957,678	V243A	probably benign	Het
Etnk2	T	A	1: 133,378,494	Y353N	probably benign	Het
Fgg	G	T	3: 83,013,015	G367V	probably damaging	Het
Gm11639	A	T	11: 104,914,895	N3076I	unknown	Het
Gm609	T	C	16: 45,443,836	T120A	probably benign	Het
Gm9772	T	C	17: 22,006,329	*61Q	probably null	Het
Grk5	T	G	19: 61,089,994	D496E	possibly damaging	Het
Hc	T	C	2: 35,019,523	N915S	probably benign	Het
Iah1	G	T	12: 21,317,387	Q31H	probably benign	Het
Insr	T	C	8: 3,169,714	D936G	probably benign	Het
Ints6	A	C	14: 62,702,453	V596G	probably benign	Het
Ispd	A	T	12: 36,390,482	N130Y	probably damaging	Het
Kcnj16	A	G	11: 111,024,851	D113G	possibly damaging	Het
Kdm4b	A	T	17: 56,399,771	I928F	probably damaging	Het
Lrrc41	C	T	4: 116,075,291		probably benign	Het
Lrrc8e	G	A	8: 4,235,070	V432I	probably benign	Het
Mamdc4	T	C	2: 25,568,489	E336G	probably benign	Het
Maml2	C	A	9: 13,621,622	Q711K		Het
Map3k14	T	C	11: 103,227,672	T563A	possibly damaging	Het
Mcu	T	A	10: 59,467,713	K101*	probably null	Het
Mettl22	T	A	16: 8,485,928	V286E	probably damaging	Het
Mon2	A	T	10: 123,009,611	N1396K	possibly damaging	Het
Mprip	T	C	11: 59,697,025		probably benign	Het
Mrpl51	C	T	6: 125,193,381	L117F	probably damaging	Het
Myo1d	C	A	11: 80,674,932	V356F	probably damaging	Het
Myo1d	T	A	11: 80,676,932	I241F	probably benign	Het
Naalad2	A	T	9: 18,385,934		probably benign	Het
Nacad	T	C	11: 6,602,853	T113A	probably benign	Het
Nrap	T	A	19: 56,364,411		probably benign	Het
Olfr1134	T	C	2: 87,656,247	I225V	possibly damaging	Het
Olfr1336	T	C	7: 6,460,764	L85P	probably damaging	Het
Olfr1358	G	A	10: 78,520,450	V281M	possibly damaging	Het
Olfr290	T	A	7: 84,916,418	I213N	possibly damaging	Het
Olfr30	T	C	11: 58,455,110	T280A	possibly damaging	Het
Olfr661	T	A	7: 104,688,180	I55N	probably damaging	Het
Osbpl3	T	C	6: 50,351,872	D117G	probably damaging	Het
Parp9	C	T	16: 35,953,611	R318*	probably null	Het
Pcdhb18	A	G	18: 37,490,321	I235V	probably benign	Het
Pex16	T	G	2: 92,379,021		probably benign	Het
Piezo2	T	A	18: 63,114,963	M489L	probably benign	Het
Pmepa1	C	A	2: 173,227,835	G271V	probably damaging	Het
Safb	A	G	17: 56,603,579	E659G	unknown	Het
Scn9a	T	C	2: 66,501,666	T1289A	probably damaging	Het
Secisbp2l	T	C	2: 125,775,676	D27G	possibly damaging	Het
Serpina1f	A	G	12: 103,693,981	V14A	probably benign	Het
Serpinb9b	C	A	13: 33,029,469	T3N	possibly damaging	Het
Sfxn5	C	T	6: 85,229,200	M315I	probably benign	Het
Slc9b2	A	G	3: 135,329,769	D333G	probably benign	Het
Sostdc1	A	G	12: 36,317,230	N135S	possibly damaging	Het
Taar7a	T	C	10: 23,993,381	N34S	probably benign	Het
Tcerg1l	C	A	7: 138,209,797	R556L	possibly damaging	Het
Tcp11l1	T	C	2: 104,688,418	K311R	probably benign	Het
Tepp	A	T	8: 95,321,255		probably benign	Het
Trbv16	T	G	6: 41,152,038	F52C	probably damaging	Het
Ttn	T	A	2: 76,895,672	R6073S	unknown	Het
Uba1y	T	C	Y: 828,818	I542T	possibly damaging	Het
Vmn1r214	T	C	13: 23,034,912	I192T	probably benign	Het
Vmn2r67	C	T	7: 85,137,138	C553Y	probably damaging	Het
Zdhhc17	G	T	10: 110,948,260	H452N	possibly damaging	Het

Other mutations in Spg11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Spg11	APN	2	122065560	missense	probably damaging	0.96
IGL00495:Spg11	APN	2	122094456	critical splice donor site	probably null
IGL00757:Spg11	APN	2	122070959	missense	probably benign	0.05
IGL01304:Spg11	APN	2	122072290	missense	probably damaging	1.00
IGL01355:Spg11	APN	2	122113156	missense	probably benign
IGL01626:Spg11	APN	2	122060971	missense	probably damaging	0.98
IGL01739:Spg11	APN	2	122114671	missense	probably damaging	1.00
IGL01835:Spg11	APN	2	122088224	missense	probably benign	0.36
IGL02129:Spg11	APN	2	122095686	missense	probably damaging	0.99
IGL02178:Spg11	APN	2	122097302	missense	probably damaging	1.00
IGL02199:Spg11	APN	2	122059553	missense	probably damaging	1.00
IGL02212:Spg11	APN	2	122108157	missense	probably benign	0.31
IGL02605:Spg11	APN	2	122092260	missense	probably benign	0.00
IGL02635:Spg11	APN	2	122113068	missense	possibly damaging	0.52
IGL02743:Spg11	APN	2	122059507	missense	probably damaging	0.97
IGL02822:Spg11	APN	2	122074534	missense	probably damaging	0.99
IGL02992:Spg11	APN	2	122058398	missense	probably damaging	1.00
IGL03010:Spg11	APN	2	122088320	missense	probably damaging	0.96
3-1:Spg11	UTSW	2	122086890	missense	probably damaging	0.98
PIT4354001:Spg11	UTSW	2	122088185	missense	probably damaging	0.98
R0131:Spg11	UTSW	2	122070968	missense	probably damaging	1.00
R0206:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0208:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0302:Spg11	UTSW	2	122092187	missense	possibly damaging	0.90
R0347:Spg11	UTSW	2	122097369	missense	probably damaging	0.99
R0357:Spg11	UTSW	2	122066232	splice site	probably benign
R0372:Spg11	UTSW	2	122059447	frame shift	probably null
R0715:Spg11	UTSW	2	122084983	missense	probably benign	0.03
R0927:Spg11	UTSW	2	122094487	missense	probably damaging	0.99
R1163:Spg11	UTSW	2	122070941	missense	probably damaging	1.00
R1534:Spg11	UTSW	2	122092325	missense	probably damaging	1.00
R1555:Spg11	UTSW	2	122097377	missense	probably damaging	0.99
R1569:Spg11	UTSW	2	122101706	missense	probably damaging	0.99
R1840:Spg11	UTSW	2	122101756	missense	probably damaging	1.00
R1929:Spg11	UTSW	2	122060207	missense	probably damaging	1.00
R2265:Spg11	UTSW	2	122108307	missense	possibly damaging	0.48
R2303:Spg11	UTSW	2	122068837	missense	probably damaging	0.99
R2510:Spg11	UTSW	2	122075310	missense	probably benign	0.03
R2760:Spg11	UTSW	2	122097359	missense	probably damaging	0.99
R2918:Spg11	UTSW	2	122075301	missense	probably damaging	0.99
R3195:Spg11	UTSW	2	122083398	critical splice donor site	probably null
R3423:Spg11	UTSW	2	122071053	missense	probably benign	0.00
R4353:Spg11	UTSW	2	122113194	missense	possibly damaging	0.92
R4407:Spg11	UTSW	2	122075332	missense	probably benign	0.00
R4644:Spg11	UTSW	2	122061029	missense	probably benign	0.03
R4663:Spg11	UTSW	2	122098099	critical splice donor site	probably null
R4684:Spg11	UTSW	2	122065076	missense	probably damaging	1.00
R4771:Spg11	UTSW	2	122065482	nonsense	probably null
R4810:Spg11	UTSW	2	122059796	missense	probably damaging	1.00
R4829:Spg11	UTSW	2	122108455	missense	probably benign	0.44
R5089:Spg11	UTSW	2	122114717	nonsense	probably null
R5362:Spg11	UTSW	2	122061000	missense	probably damaging	0.99
R5684:Spg11	UTSW	2	122093503	missense	probably damaging	1.00
R5899:Spg11	UTSW	2	122098199	missense	possibly damaging	0.67
R5923:Spg11	UTSW	2	122093478	missense	probably damaging	0.98
R6052:Spg11	UTSW	2	122097356	missense	probably damaging	0.99
R6111:Spg11	UTSW	2	122093482	missense	probably damaging	0.98
R6174:Spg11	UTSW	2	122086805	splice site	probably null
R6226:Spg11	UTSW	2	122088262	missense	possibly damaging	0.69
R6336:Spg11	UTSW	2	122112959	splice site	probably null
R6480:Spg11	UTSW	2	122092305	missense	probably benign	0.03
R6494:Spg11	UTSW	2	122113225	missense	probably damaging	0.98
R6582:Spg11	UTSW	2	122092292	missense	probably damaging	0.99
R6714:Spg11	UTSW	2	122095731	missense	probably damaging	0.99
R6791:Spg11	UTSW	2	122093443	missense	probably damaging	0.99
R6836:Spg11	UTSW	2	122059535	missense	probably damaging	1.00
R6928:Spg11	UTSW	2	122069904	missense	probably benign	0.37
R7179:Spg11	UTSW	2	122101789	splice site	probably null
R7229:Spg11	UTSW	2	122108104	missense	probably damaging	0.98
R7337:Spg11	UTSW	2	122084993	missense	probably benign	0.09
R7338:Spg11	UTSW	2	122055377	missense	probably damaging	1.00
R7351:Spg11	UTSW	2	122069931	missense	possibly damaging	0.95
R7378:Spg11	UTSW	2	122058429	missense	probably damaging	1.00
R7448:Spg11	UTSW	2	122093545	critical splice acceptor site	probably null
R7505:Spg11	UTSW	2	122075351	nonsense	probably null
R7665:Spg11	UTSW	2	122066267	missense	probably damaging	0.99
R7685:Spg11	UTSW	2	122068880	missense	probably damaging	0.99
R7779:Spg11	UTSW	2	122070939	missense	probably damaging	1.00
R7947:Spg11	UTSW	2	122092322	missense	probably damaging	1.00
R7958:Spg11	UTSW	2	122092945	splice site	probably null
R8024:Spg11	UTSW	2	122097321	missense	possibly damaging	0.67
R8033:Spg11	UTSW	2	122086951	missense	probably damaging	1.00
R8069:Spg11	UTSW	2	122113156	missense	probably benign
R8121:Spg11	UTSW	2	122069867	critical splice donor site	probably null
R8252:Spg11	UTSW	2	122088339	splice site	probably benign
R8358:Spg11	UTSW	2	122080258	missense	possibly damaging	0.69
R8362:Spg11	UTSW	2	122118361	missense	unknown
R8385:Spg11	UTSW	2	122097321	missense	probably benign	0.22
R8406:Spg11	UTSW	2	122093442	missense	probably damaging	0.99
R8480:Spg11	UTSW	2	122113079	missense	probably damaging	1.00
R8883:Spg11	UTSW	2	122113080	missense	probably damaging	1.00
R8968:Spg11	UTSW	2	122092206	missense	probably damaging	0.99
R9008:Spg11	UTSW	2	122069932	missense	probably benign	0.05
R9059:Spg11	UTSW	2	122088307	missense	probably damaging	0.99
R9296:Spg11	UTSW	2	122114694	missense	probably benign	0.34
R9333:Spg11	UTSW	2	122101763	missense	probably damaging	0.99
R9657:Spg11	UTSW	2	122080300	missense	probably damaging	1.00
R9774:Spg11	UTSW	2	122108484	missense	probably damaging	0.99
Z1177:Spg11	UTSW	2	122072985	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGAATGCTATGTTGACACCC -3'
(R):5'- GGTTTTCTCACAAGCTGATTCC -3'

Sequencing Primer
(F):5'- AATGCTATGTTGACACCCTGAGG -3'
(R):5'- GTCCATCTGTGTGATCGAGGCC -3'

Posted On

2021-04-30