Mutagenetix > Incidental Mutation

Incidental Mutation 'R6836:Spg11'

534550

Institutional Source

Beutler Lab

Gene Symbol

Spg11

Ensembl Gene

ENSMUSG00000033396

Gene Name

SPG11, spatacsin vesicle trafficking associated

Synonyms

C530005A01Rik, 6030465E24Rik

Accession Numbers

Genbank: NM_145531

Essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R6836 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122053520-122118386 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 122059535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 2109 (A2109T)

Ref Sequence

ENSEMBL: ENSMUSP00000037543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028668] [ENSMUST00000036450]

AlphaFold

Q3UHA3

Predicted Effect

probably benign
Transcript: ENSMUST00000028668

SMART Domains

Protein: ENSMUSP00000028668
Gene: ENSMUSG00000027236

Domain	Start	End	E-Value	Type
Pfam:eIF3_subunit	14	261	7.5e-66	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000036450
AA Change: A2109T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: A2109T

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	254	276	N/A	INTRINSIC
low complexity region	945	958	N/A	INTRINSIC
low complexity region	1250	1264	N/A	INTRINSIC
low complexity region	1305	1313	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
low complexity region	1772	1784	N/A	INTRINSIC
Pfam:Spatacsin_C	2082	2374	1.1e-105	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,196,504	I81F	possibly damaging	Het
Adamtsl2	T	C	2: 27,081,706	M1T	probably null	Het
Aim2	C	G	1: 173,463,980	T317R	probably damaging	Het
Alox8	T	C	11: 69,186,505	Y473C	probably damaging	Het
Alox8	T	C	11: 69,189,889	R209G	possibly damaging	Het
Asb5	A	G	8: 54,585,071	M210V	probably benign	Het
Atp2c2	T	A	8: 119,734,415	L249Q	probably damaging	Het
AU018091	T	G	7: 3,164,156	D77A	probably damaging	Het
Bahcc1	A	T	11: 120,271,757	K294*	probably null	Het
Baz2b	C	T	2: 59,917,425	R1298Q	probably damaging	Het
Bivm	T	A	1: 44,143,136	N501K	possibly damaging	Het
Bpifb5	T	A	2: 154,228,065	I145N	probably benign	Het
Casq2	A	T	3: 102,086,760	N41I	probably damaging	Het
Ccdc18	T	C	5: 108,197,967	L993P	probably damaging	Het
Cfap44	A	G	16: 44,404,079	D50G	probably damaging	Het
Clca3a2	T	A	3: 144,806,383	I91F	probably damaging	Het
Crebbp	T	A	16: 4,180,022	H66L	possibly damaging	Het
Cyfip2	T	C	11: 46,272,640	T321A	probably benign	Het
Dido1	A	G	2: 180,662,307	V1268A	probably benign	Het
E030030I06Rik	A	C	10: 22,148,492	V174G	probably damaging	Het
Gm20730	G	T	6: 43,081,833		probably null	Het
Gm36176	T	C	10: 77,847,142		probably benign	Het
Gper1	T	A	5: 139,426,680	M260K	probably damaging	Het
Igfbp2	T	C	1: 72,849,658	L89P	probably damaging	Het
Katnal1	T	C	5: 148,894,164	N200S	probably damaging	Het
Kcnk13	G	T	12: 100,061,689	R341L	probably damaging	Het
Klhl20	T	A	1: 161,105,406	E277D	probably benign	Het
Lingo1	T	C	9: 56,619,772	Y517C	probably damaging	Het
Lrrk1	C	T	7: 66,342,779	E82K	probably benign	Het
Mtor	T	A	4: 148,489,498	V1275D	possibly damaging	Het
Ncan	C	T	8: 70,100,315	S1089N	possibly damaging	Het
Notch4	C	T	17: 34,586,100	T1643I	probably damaging	Het
Olfr1258	T	C	2: 89,930,339	C177R	probably damaging	Het
Olfr1357	A	G	10: 78,612,590	L17P	probably damaging	Het
Olfr1387	A	T	11: 49,460,077	T133S	possibly damaging	Het
Olfr539	A	C	7: 140,668,180	I298L	possibly damaging	Het
Pcdhgb6	T	C	18: 37,742,962	V241A	probably benign	Het
Phf11b	T	A	14: 59,328,123	T102S	possibly damaging	Het
Pkd1	T	A	17: 24,581,259	V2998E	probably damaging	Het
Ppp1r13b	T	C	12: 111,835,195	S352G	probably benign	Het
Ptprh	C	T	7: 4,551,135	V778M	probably damaging	Het
Ptprz1	C	T	6: 23,030,665	Q1008*	probably null	Het
Ralgapa1	A	T	12: 55,604,273		probably null	Het
Rbm20	G	A	19: 53,814,069	G336E	probably damaging	Het
Sdsl	T	C	5: 120,462,102	I77V	probably benign	Het
Serpina3b	G	A	12: 104,134,082	E308K	probably benign	Het
Sfrp5	G	A	19: 42,201,710	T101I	probably damaging	Het
Slc2a13	C	T	15: 91,321,632	V451I	probably benign	Het
Slc6a9	C	T	4: 117,867,886	A559V	possibly damaging	Het
Stard9	C	T	2: 120,699,843	R2194C	probably benign	Het
Tfeb	T	C	17: 47,786,198		probably null	Het
Tiam2	T	A	17: 3,414,380	I128N	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tpr	T	G	1: 150,436,673		probably null	Het
Traf3ip1	T	C	1: 91,521,000	I456T	probably benign	Het
Ttll4	T	A	1: 74,689,413	D892E	probably damaging	Het
Ubr1	T	A	2: 120,896,675		probably null	Het
Vmn2r74	T	A	7: 85,957,422	I239F	probably benign	Het
Wdfy3	C	T	5: 101,952,999	V251M	probably damaging	Het
Xylb	T	A	9: 119,391,754	L531H	probably damaging	Het
Zfp960	T	A	17: 17,088,172	C383S	probably damaging	Het

Other mutations in Spg11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Spg11	APN	2	122065560	missense	probably damaging	0.96
IGL00495:Spg11	APN	2	122094456	critical splice donor site	probably null
IGL00757:Spg11	APN	2	122070959	missense	probably benign	0.05
IGL01304:Spg11	APN	2	122072290	missense	probably damaging	1.00
IGL01355:Spg11	APN	2	122113156	missense	probably benign
IGL01626:Spg11	APN	2	122060971	missense	probably damaging	0.98
IGL01739:Spg11	APN	2	122114671	missense	probably damaging	1.00
IGL01835:Spg11	APN	2	122088224	missense	probably benign	0.36
IGL02129:Spg11	APN	2	122095686	missense	probably damaging	0.99
IGL02178:Spg11	APN	2	122097302	missense	probably damaging	1.00
IGL02199:Spg11	APN	2	122059553	missense	probably damaging	1.00
IGL02212:Spg11	APN	2	122108157	missense	probably benign	0.31
IGL02605:Spg11	APN	2	122092260	missense	probably benign	0.00
IGL02635:Spg11	APN	2	122113068	missense	possibly damaging	0.52
IGL02743:Spg11	APN	2	122059507	missense	probably damaging	0.97
IGL02822:Spg11	APN	2	122074534	missense	probably damaging	0.99
IGL02992:Spg11	APN	2	122058398	missense	probably damaging	1.00
IGL03010:Spg11	APN	2	122088320	missense	probably damaging	0.96
3-1:Spg11	UTSW	2	122086890	missense	probably damaging	0.98
PIT4354001:Spg11	UTSW	2	122088185	missense	probably damaging	0.98
R0131:Spg11	UTSW	2	122070968	missense	probably damaging	1.00
R0206:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0208:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0302:Spg11	UTSW	2	122092187	missense	possibly damaging	0.90
R0347:Spg11	UTSW	2	122097369	missense	probably damaging	0.99
R0357:Spg11	UTSW	2	122066232	splice site	probably benign
R0372:Spg11	UTSW	2	122059447	frame shift	probably null
R0715:Spg11	UTSW	2	122084983	missense	probably benign	0.03
R0927:Spg11	UTSW	2	122094487	missense	probably damaging	0.99
R1163:Spg11	UTSW	2	122070941	missense	probably damaging	1.00
R1534:Spg11	UTSW	2	122092325	missense	probably damaging	1.00
R1555:Spg11	UTSW	2	122097377	missense	probably damaging	0.99
R1569:Spg11	UTSW	2	122101706	missense	probably damaging	0.99
R1840:Spg11	UTSW	2	122101756	missense	probably damaging	1.00
R1929:Spg11	UTSW	2	122060207	missense	probably damaging	1.00
R2265:Spg11	UTSW	2	122108307	missense	possibly damaging	0.48
R2303:Spg11	UTSW	2	122068837	missense	probably damaging	0.99
R2510:Spg11	UTSW	2	122075310	missense	probably benign	0.03
R2760:Spg11	UTSW	2	122097359	missense	probably damaging	0.99
R2918:Spg11	UTSW	2	122075301	missense	probably damaging	0.99
R3195:Spg11	UTSW	2	122083398	critical splice donor site	probably null
R3423:Spg11	UTSW	2	122071053	missense	probably benign	0.00
R4353:Spg11	UTSW	2	122113194	missense	possibly damaging	0.92
R4407:Spg11	UTSW	2	122075332	missense	probably benign	0.00
R4644:Spg11	UTSW	2	122061029	missense	probably benign	0.03
R4663:Spg11	UTSW	2	122098099	critical splice donor site	probably null
R4684:Spg11	UTSW	2	122065076	missense	probably damaging	1.00
R4771:Spg11	UTSW	2	122065482	nonsense	probably null
R4810:Spg11	UTSW	2	122059796	missense	probably damaging	1.00
R4829:Spg11	UTSW	2	122108455	missense	probably benign	0.44
R5089:Spg11	UTSW	2	122114717	nonsense	probably null
R5362:Spg11	UTSW	2	122061000	missense	probably damaging	0.99
R5684:Spg11	UTSW	2	122093503	missense	probably damaging	1.00
R5899:Spg11	UTSW	2	122098199	missense	possibly damaging	0.67
R5923:Spg11	UTSW	2	122093478	missense	probably damaging	0.98
R6052:Spg11	UTSW	2	122097356	missense	probably damaging	0.99
R6111:Spg11	UTSW	2	122093482	missense	probably damaging	0.98
R6174:Spg11	UTSW	2	122086805	splice site	probably null
R6226:Spg11	UTSW	2	122088262	missense	possibly damaging	0.69
R6336:Spg11	UTSW	2	122112959	splice site	probably null
R6480:Spg11	UTSW	2	122092305	missense	probably benign	0.03
R6494:Spg11	UTSW	2	122113225	missense	probably damaging	0.98
R6582:Spg11	UTSW	2	122092292	missense	probably damaging	0.99
R6714:Spg11	UTSW	2	122095731	missense	probably damaging	0.99
R6791:Spg11	UTSW	2	122093443	missense	probably damaging	0.99
R6928:Spg11	UTSW	2	122069904	missense	probably benign	0.37
R7179:Spg11	UTSW	2	122101789	splice site	probably null
R7229:Spg11	UTSW	2	122108104	missense	probably damaging	0.98
R7337:Spg11	UTSW	2	122084993	missense	probably benign	0.09
R7338:Spg11	UTSW	2	122055377	missense	probably damaging	1.00
R7351:Spg11	UTSW	2	122069931	missense	possibly damaging	0.95
R7378:Spg11	UTSW	2	122058429	missense	probably damaging	1.00
R7448:Spg11	UTSW	2	122093545	critical splice acceptor site	probably null
R7505:Spg11	UTSW	2	122075351	nonsense	probably null
R7665:Spg11	UTSW	2	122066267	missense	probably damaging	0.99
R7685:Spg11	UTSW	2	122068880	missense	probably damaging	0.99
R7779:Spg11	UTSW	2	122070939	missense	probably damaging	1.00
R7947:Spg11	UTSW	2	122092322	missense	probably damaging	1.00
R7958:Spg11	UTSW	2	122092945	splice site	probably null
R8024:Spg11	UTSW	2	122097321	missense	possibly damaging	0.67
R8033:Spg11	UTSW	2	122086951	missense	probably damaging	1.00
R8069:Spg11	UTSW	2	122113156	missense	probably benign
R8121:Spg11	UTSW	2	122069867	critical splice donor site	probably null
R8252:Spg11	UTSW	2	122088339	splice site	probably benign
R8358:Spg11	UTSW	2	122080258	missense	possibly damaging	0.69
R8362:Spg11	UTSW	2	122118361	missense	unknown
R8385:Spg11	UTSW	2	122097321	missense	probably benign	0.22
R8406:Spg11	UTSW	2	122093442	missense	probably damaging	0.99
R8480:Spg11	UTSW	2	122113079	missense	probably damaging	1.00
R8810:Spg11	UTSW	2	122070944	missense	probably damaging	0.98
R8883:Spg11	UTSW	2	122113080	missense	probably damaging	1.00
R8968:Spg11	UTSW	2	122092206	missense	probably damaging	0.99
R9008:Spg11	UTSW	2	122069932	missense	probably benign	0.05
R9059:Spg11	UTSW	2	122088307	missense	probably damaging	0.99
R9296:Spg11	UTSW	2	122114694	missense	probably benign	0.34
R9333:Spg11	UTSW	2	122101763	missense	probably damaging	0.99
R9657:Spg11	UTSW	2	122080300	missense	probably damaging	1.00
R9774:Spg11	UTSW	2	122108484	missense	probably damaging	0.99
Z1177:Spg11	UTSW	2	122072985	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCCAGAGACCCTATCAGCTGC -3'
(R):5'- GACAAGATTCCCTCTGTCCC -3'

Sequencing Primer
(F):5'- CAAGCTGGGGCCCTTGTC -3'
(R):5'- ACGGGGAGCTGTCTTGC -3'

Posted On

2018-09-12