Incidental Mutation 'R2326:Saal1'
ID244915
Institutional Source Beutler Lab
Gene Symbol Saal1
Ensembl Gene ENSMUSG00000006763
Gene Nameserum amyloid A-like 1
Synonyms5031425D22Rik
MMRRC Submission 040317-MU
Accession Numbers

Genbank: NM_030233

Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46686108-46710680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46692811 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 403 (F403L)
Ref Sequence ENSEMBL: ENSMUSP00000120658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143082]
Predicted Effect probably benign
Transcript: ENSMUST00000143082
AA Change: F403L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000120658
Gene: ENSMUSG00000006763
AA Change: F403L

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
SCOP:d1gw5a_ 40 455 2e-5 SMART
low complexity region 456 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210791
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Saal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02727:Saal1 APN 7 46689799 splice site probably null
IGL03301:Saal1 APN 7 46702520 splice site probably benign
G5030:Saal1 UTSW 7 46692783 missense probably damaging 1.00
R0021:Saal1 UTSW 7 46692892 missense probably damaging 0.96
R0765:Saal1 UTSW 7 46699647 missense possibly damaging 0.76
R1086:Saal1 UTSW 7 46689459 splice site probably benign
R1273:Saal1 UTSW 7 46692942 missense probably damaging 0.99
R1466:Saal1 UTSW 7 46702545 splice site probably null
R1466:Saal1 UTSW 7 46702545 splice site probably null
R1661:Saal1 UTSW 7 46692800 missense possibly damaging 0.93
R1695:Saal1 UTSW 7 46692916 missense probably damaging 0.97
R2018:Saal1 UTSW 7 46699489 missense possibly damaging 0.93
R2058:Saal1 UTSW 7 46699456 missense probably damaging 1.00
R2059:Saal1 UTSW 7 46699456 missense probably damaging 1.00
R4182:Saal1 UTSW 7 46710652 unclassified probably benign
R4704:Saal1 UTSW 7 46699740 intron probably benign
R4831:Saal1 UTSW 7 46699647 missense probably benign 0.22
R5270:Saal1 UTSW 7 46701733 intron probably benign
R5471:Saal1 UTSW 7 46699648 missense probably benign 0.06
R5790:Saal1 UTSW 7 46701928 missense probably damaging 1.00
R6699:Saal1 UTSW 7 46692817 missense probably damaging 1.00
R6804:Saal1 UTSW 7 46699640 frame shift probably null
R6934:Saal1 UTSW 7 46702664 missense probably benign 0.00
R7863:Saal1 UTSW 7 46692903 missense probably benign 0.08
R8076:Saal1 UTSW 7 46710607 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACAAGGAGCCCTGTGTTTG -3'
(R):5'- CACTAGTTCAGGTTGGCTGG -3'

Sequencing Primer
(F):5'- AGCCCTGTGTTTGCCCGG -3'
(R):5'- CCCTTGATTTCATGCAGGGGATC -3'
Posted On2014-10-30