Incidental Mutation 'R2326:Dazap1'
ID244924
Institutional Source Beutler Lab
Gene Symbol Dazap1
Ensembl Gene ENSMUSG00000069565
Gene NameDAZ associated protein 1
Synonyms2410042M16Rik, mPrrp
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80261486-80288408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80284233 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 234 (M234K)
Ref Sequence ENSEMBL: ENSMUSP00000101000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092305] [ENSMUST00000105361] [ENSMUST00000105362] [ENSMUST00000156935]
Predicted Effect unknown
Transcript: ENSMUST00000092305
AA Change: M235K
SMART Domains Protein: ENSMUSP00000089958
Gene: ENSMUSG00000069565
AA Change: M235K

DomainStartEndE-ValueType
RRM 11 83 1.89e-24 SMART
RRM 114 186 6.25e-25 SMART
low complexity region 238 261 N/A INTRINSIC
low complexity region 270 332 N/A INTRINSIC
low complexity region 363 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105361
AA Change: M234K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101000
Gene: ENSMUSG00000069565
AA Change: M234K

DomainStartEndE-ValueType
RRM 11 83 1.89e-24 SMART
RRM 113 185 6.25e-25 SMART
low complexity region 237 260 N/A INTRINSIC
low complexity region 269 331 N/A INTRINSIC
low complexity region 363 394 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105362
AA Change: M234K
SMART Domains Protein: ENSMUSP00000101001
Gene: ENSMUSG00000069565
AA Change: M234K

DomainStartEndE-ValueType
RRM 11 83 1.89e-24 SMART
RRM 113 185 6.25e-25 SMART
low complexity region 237 260 N/A INTRINSIC
low complexity region 269 331 N/A INTRINSIC
low complexity region 362 393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151619
Predicted Effect probably benign
Transcript: ENSMUST00000156935
SMART Domains Protein: ENSMUSP00000117497
Gene: ENSMUSG00000069565

DomainStartEndE-ValueType
RRM 3 75 1.89e-24 SMART
RRM 105 171 6.71e-16 SMART
Meta Mutation Damage Score 0.1249 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show partial lethality during fetal growth through weaning, growth retardation, spermatogenic arrest, and premature death. Homozygotes for a hypomorphic allele live longer but are small and sterile and display small gonads, spermatogenic arrest, and abnormal pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Dazap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03151:Dazap1 APN 10 80280920 splice site probably benign
R0058:Dazap1 UTSW 10 80261581 splice site probably benign
R0058:Dazap1 UTSW 10 80261581 splice site probably benign
R0131:Dazap1 UTSW 10 80278226 splice site probably null
R0132:Dazap1 UTSW 10 80278226 splice site probably null
R0938:Dazap1 UTSW 10 80280961 missense possibly damaging 0.82
R1976:Dazap1 UTSW 10 80274620 splice site probably null
R2233:Dazap1 UTSW 10 80277599 missense possibly damaging 0.69
R2234:Dazap1 UTSW 10 80277599 missense possibly damaging 0.69
R3619:Dazap1 UTSW 10 80285360 unclassified probably benign
R3747:Dazap1 UTSW 10 80287664 missense possibly damaging 0.94
R6009:Dazap1 UTSW 10 80285304 unclassified probably benign
R6324:Dazap1 UTSW 10 80277660 missense probably benign 0.17
R6484:Dazap1 UTSW 10 80277647 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTGGGAAGAGCTGCTTAAGG -3'
(R):5'- ACTCACTGAACTGTGGTGGG -3'

Sequencing Primer
(F):5'- ATCTTGGTGCAGCAGAGC -3'
(R):5'- TCCAGGCGGTGTGGATAC -3'
Posted On2014-10-30