Incidental Mutation 'R2326:Slc23a2'
ID244905
Institutional Source Beutler Lab
Gene Symbol Slc23a2
Ensembl Gene ENSMUSG00000027340
Gene Namesolute carrier family 23 (nucleobase transporters), member 2
SynonymsSlc23a1, SVCT2, YSPL3
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location132052496-132145108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132094195 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 52 (E52K)
Ref Sequence ENSEMBL: ENSMUSP00000028815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028815] [ENSMUST00000128899]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028815
AA Change: E52K

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028815
Gene: ENSMUSG00000027340
AA Change: E52K

DomainStartEndE-ValueType
Pfam:Xan_ur_permease 101 534 1.7e-93 PFAM
transmembrane domain 547 566 N/A INTRINSIC
low complexity region 578 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127724
Predicted Effect probably benign
Transcript: ENSMUST00000128899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133407
Meta Mutation Damage Score 0.1352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two required transporters and the encoded protein accounts for tissue-specific uptake of vitamin C. Previously, this gene had an official symbol of SLC23A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within minutes of birth from respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Slc23a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc23a2 APN 2 132101500 missense probably benign 0.00
IGL01123:Slc23a2 APN 2 132056816 missense probably benign 0.02
IGL03115:Slc23a2 APN 2 132091265 missense probably damaging 1.00
R0352:Slc23a2 UTSW 2 132060796 missense probably benign 0.03
R0446:Slc23a2 UTSW 2 132078433 missense probably benign 0.06
R0499:Slc23a2 UTSW 2 132072017 missense probably damaging 1.00
R1252:Slc23a2 UTSW 2 132062197 splice site probably null
R1663:Slc23a2 UTSW 2 132065464 missense probably damaging 1.00
R1768:Slc23a2 UTSW 2 132075641 missense probably benign
R1914:Slc23a2 UTSW 2 132056766 missense probably damaging 0.99
R2277:Slc23a2 UTSW 2 132091259 missense possibly damaging 0.54
R2385:Slc23a2 UTSW 2 132089201 missense probably benign 0.01
R4049:Slc23a2 UTSW 2 132060683 missense probably benign 0.00
R4084:Slc23a2 UTSW 2 132091217 nonsense probably null
R4497:Slc23a2 UTSW 2 132056782 nonsense probably null
R4710:Slc23a2 UTSW 2 132056709 missense probably benign
R4873:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R4875:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R5008:Slc23a2 UTSW 2 132101494 missense probably damaging 0.99
R5164:Slc23a2 UTSW 2 132075450 intron probably benign
R5236:Slc23a2 UTSW 2 132075584 missense probably damaging 0.97
R6587:Slc23a2 UTSW 2 132078481 missense possibly damaging 0.70
R6738:Slc23a2 UTSW 2 132078436 missense probably benign 0.10
R6960:Slc23a2 UTSW 2 132091253 missense probably damaging 1.00
R7000:Slc23a2 UTSW 2 132094203 missense possibly damaging 0.93
R7062:Slc23a2 UTSW 2 132091269 missense probably damaging 0.99
R7293:Slc23a2 UTSW 2 132089106 missense probably benign 0.02
R7324:Slc23a2 UTSW 2 132089123 missense probably damaging 1.00
X0011:Slc23a2 UTSW 2 132091263 missense possibly damaging 0.64
X0018:Slc23a2 UTSW 2 132066806 missense probably benign 0.30
Z1176:Slc23a2 UTSW 2 132060788 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCCAAGGCTTTTACAAATACCTAG -3'
(R):5'- CGCTGCGATATGTAATGCGC -3'

Sequencing Primer
(F):5'- ACCTAGTAATTATGACTCTTCC -3'
(R):5'- AATGCGCAGTTTAGGGCTCTC -3'
Posted On2014-10-30