Mutagenetix > Incidental Mutations

Incidental Mutation 'R5022:Ptpn21'

389285

Institutional Source

Beutler Lab

Gene Symbol

Ptpn21

Ensembl Gene

ENSMUSG00000021009

Gene Name

protein tyrosine phosphatase, non-receptor type 21

Synonyms

PTPD1, PTPRL10

MMRRC Submission

042613-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R5022 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98676741-98737405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 98679407 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1091 (R1091C)

Ref Sequence

ENSEMBL: ENSMUSP00000126975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085116
AA Change: R1091C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: R1091C

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000170188
AA Change: R1091C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: R1091C

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221148

Predicted Effect

probably benign
Transcript: ENSMUST00000221535

Predicted Effect

probably benign
Transcript: ENSMUST00000221932

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223321

Meta Mutation Damage Score

0.2077

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	TCGACTGC	T	4: 53,041,570		probably null	Het
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Rnf20	A	G	4: 49,642,016		probably benign	Het
Ros1	A	G	10: 52,124,075	V1118A	possibly damaging	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Slc8a3	A	G	12: 81,199,558	V900A	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tlk1	A	T	2: 70,742,065	N386K	probably benign	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Ptpn21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Ptpn21	APN	12	98680468	missense	probably damaging	1.00
IGL00576:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00577:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00580:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00583:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00773:Ptpn21	APN	12	98688313	missense	probably benign	0.00
IGL00780:Ptpn21	APN	12	98680371	missense	probably damaging	1.00
IGL01516:Ptpn21	APN	12	98715189	missense	probably damaging	1.00
IGL01616:Ptpn21	APN	12	98680013	missense	probably damaging	1.00
IGL01939:Ptpn21	APN	12	98689161	missense	probably damaging	0.96
IGL02237:Ptpn21	APN	12	98705092	critical splice donor site	probably null
IGL02512:Ptpn21	APN	12	98679392	missense	probably benign	0.00
IGL02852:Ptpn21	APN	12	98715195	critical splice acceptor site	probably null
IGL02894:Ptpn21	APN	12	98689632	splice site	probably benign
IGL03024:Ptpn21	APN	12	98680056	missense	probably benign
IGL03220:Ptpn21	APN	12	98678623	missense	probably damaging	1.00
R0144:Ptpn21	UTSW	12	98688609	missense	probably benign	0.01
R0472:Ptpn21	UTSW	12	98704240	splice site	probably benign
R0675:Ptpn21	UTSW	12	98688216	missense	probably benign	0.16
R0771:Ptpn21	UTSW	12	98689080	missense	probably damaging	1.00
R1434:Ptpn21	UTSW	12	98688590	missense	probably damaging	1.00
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1837:Ptpn21	UTSW	12	98733626	missense	probably damaging	0.99
R1897:Ptpn21	UTSW	12	98680405	unclassified	probably null
R2048:Ptpn21	UTSW	12	98689526	missense	possibly damaging	0.94
R2376:Ptpn21	UTSW	12	98688314	missense	possibly damaging	0.62
R3709:Ptpn21	UTSW	12	98688541	missense	probably benign
R4197:Ptpn21	UTSW	12	98680138	missense	probably damaging	1.00
R4283:Ptpn21	UTSW	12	98733475	missense	probably damaging	0.99
R4368:Ptpn21	UTSW	12	98678593	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98688248	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98715060	missense	probably damaging	0.98
R4703:Ptpn21	UTSW	12	98679392	missense	probably benign	0.00
R4737:Ptpn21	UTSW	12	98708844	missense	probably benign	0.03
R4829:Ptpn21	UTSW	12	98689296	missense	probably damaging	1.00
R4926:Ptpn21	UTSW	12	98715195	critical splice acceptor site	probably null
R4974:Ptpn21	UTSW	12	98680103	missense	probably damaging	1.00
R5057:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5395:Ptpn21	UTSW	12	98715117	missense	probably damaging	1.00
R5608:Ptpn21	UTSW	12	98688777	missense	probably benign	0.00
R5741:Ptpn21	UTSW	12	98679289	missense	probably damaging	1.00
R5785:Ptpn21	UTSW	12	98682550	missense	probably damaging	0.99
R5959:Ptpn21	UTSW	12	98708889	splice site	probably null
R5968:Ptpn21	UTSW	12	98710890	missense	probably damaging	1.00
R5984:Ptpn21	UTSW	12	98689076	missense	probably damaging	1.00
R6005:Ptpn21	UTSW	12	98678552	makesense	probably null
R6181:Ptpn21	UTSW	12	98699999	missense	probably damaging	0.99
R6226:Ptpn21	UTSW	12	98680116	missense	probably benign	0.24
R6226:Ptpn21	UTSW	12	98715172	missense	probably damaging	1.00
R6317:Ptpn21	UTSW	12	98689262	missense	probably damaging	1.00
R6370:Ptpn21	UTSW	12	98689034	missense	possibly damaging	0.86
R6485:Ptpn21	UTSW	12	98698872	nonsense	probably null
R6894:Ptpn21	UTSW	12	98715181	missense	probably damaging	1.00
R7122:Ptpn21	UTSW	12	98688912	missense	probably damaging	0.99
R7232:Ptpn21	UTSW	12	98688737	missense	probably benign	0.17
R7289:Ptpn21	UTSW	12	98704191	missense	probably benign	0.35
R7327:Ptpn21	UTSW	12	98680101	missense	probably damaging	1.00
R7474:Ptpn21	UTSW	12	98737363	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCAGAAGCTATGGGCCAC -3'
(R):5'- GAGACACCAACTTGCCTTCAGTC -3'

Sequencing Primer
(F):5'- CTTCCCAGCGCTCACTG -3'
(R):5'- TGCCTTCAGTCACCATCGGG -3'

Posted On

2016-06-06