Mutagenetix > Incidental Mutation

Incidental Mutation 'R4737:Ptpn21'

359365

Institutional Source

Beutler Lab

Gene Symbol

Ptpn21

Ensembl Gene

ENSMUSG00000021009

Gene Name

protein tyrosine phosphatase, non-receptor type 21

Synonyms

PTPD1, PTPRL10

MMRRC Submission

042024-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R4737 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98676741-98737405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98708844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 183 (E183G)

Ref Sequence

ENSEMBL: ENSMUSP00000126975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000085116
AA Change: E183G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: E183G

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170188
AA Change: E183G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: E183G

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221148
AA Change: E183G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

probably benign
Transcript: ENSMUST00000221535
AA Change: E183G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000221932
AA Change: E183G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222071

Meta Mutation Damage Score

0.0836

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

100% (94/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	A	G	1: 181,227,819		noncoding transcript	Het
Acp2	A	T	2: 91,210,723	R419W	probably benign	Het
Actr5	A	G	2: 158,628,071	N207S	probably damaging	Het
Afap1	G	A	5: 35,961,782	V254M	probably benign	Het
Arfgef1	A	T	1: 10,189,611	M544K	possibly damaging	Het
Arhgap5	A	T	12: 52,519,077	M944L	probably benign	Het
Bnip3l-ps	G	A	12: 18,216,772		noncoding transcript	Het
Carf	A	G	1: 60,109,318	T58A	probably benign	Het
Carns1	A	G	19: 4,170,928		probably benign	Het
Ccp110	T	A	7: 118,724,548	I670K	possibly damaging	Het
Cftr	T	A	6: 18,299,883	D1218E	probably benign	Het
Chrna9	A	T	5: 65,967,871	T52S	probably damaging	Het
Chst9	T	C	18: 15,452,777	Y243C	probably damaging	Het
Clk2	A	T	3: 89,168,709	H62L	probably benign	Het
Cntnap2	A	T	6: 45,060,317	R10W	possibly damaging	Het
Cpt1b	C	T	15: 89,421,406	D369N	probably benign	Het
Crhr2	G	T	6: 55,091,305	H423Q	probably damaging	Het
D8Ertd738e	T	A	8: 84,249,521	I33F	probably damaging	Het
Dbt	T	C	3: 116,539,132	I200T	probably damaging	Het
Ddhd1	A	T	14: 45,628,821		probably benign	Het
Ddx27	A	G	2: 167,029,299	I480V	probably benign	Het
Dpp9	A	C	17: 56,198,970		probably null	Het
Dpy19l3	A	T	7: 35,703,501	M562K	probably damaging	Het
Dus3l	T	C	17: 56,767,868	L330P	probably damaging	Het
Efcab7	C	T	4: 99,831,568	Q96*	probably null	Het
Egfr	T	C	11: 16,869,231	F254L	probably damaging	Het
Eml5	C	T	12: 98,798,852	V1566M	probably damaging	Het
Entpd7	T	A	19: 43,691,195	Y62*	probably null	Het
Erbb4	T	C	1: 68,343,900	M313V	probably damaging	Het
Gm5528	A	G	1: 72,004,552		noncoding transcript	Het
H2-M9	G	T	17: 36,640,739	Y281*	probably null	Het
Hmcn1	T	G	1: 150,689,595	K2260N	possibly damaging	Het
Hnf4a	A	G	2: 163,564,219	I259V	probably benign	Het
Ick	A	G	9: 78,150,654	T162A	probably damaging	Het
Insm1	A	T	2: 146,222,902	T213S	probably benign	Het
Iqca	T	C	1: 90,077,822	D488G	probably damaging	Het
Kdm5a	T	A	6: 120,406,015		probably benign	Het
Kdm7a	G	C	6: 39,152,839	L468V	possibly damaging	Het
Lck	G	A	4: 129,555,984	T229I	possibly damaging	Het
Lig3	T	C	11: 82,787,727	L265P	probably damaging	Het
Lipa	T	A	19: 34,501,634	K229*	probably null	Het
Lrrk1	C	T	7: 66,306,873	S418N	probably benign	Het
Mark2	A	G	19: 7,281,232	V126A	probably damaging	Het
Met	T	C	6: 17,491,541	C101R	probably damaging	Het
Mkln1	A	T	6: 31,426,799	K85M	probably damaging	Het
Mst1	A	G	9: 108,080,521	R15G	probably benign	Het
Muc6	T	G	7: 141,640,159		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Myo7b	T	C	18: 31,998,602	S514G	probably damaging	Het
Narfl	A	T	17: 25,781,309	H322L	probably damaging	Het
Nars	T	C	18: 64,516,427	E11G	probably benign	Het
Ogdh	T	A	11: 6,297,044	F23I	probably benign	Het
Olfr1121	T	C	2: 87,372,321	I263T	probably damaging	Het
Olfr1186	C	T	2: 88,526,225	S214F	probably damaging	Het
Olfr1238	C	T	2: 89,406,486	V198I	probably benign	Het
Olfr1272	A	G	2: 90,282,381	S65P	probably damaging	Het
Olfr584	C	T	7: 103,085,914	A127V	probably damaging	Het
Olfr825	T	A	10: 130,162,838	T163S	probably benign	Het
Olfr979	A	T	9: 40,000,422	D268E	probably damaging	Het
Otub2	T	A	12: 103,392,844	L64Q	probably benign	Het
Pappa2	T	C	1: 158,957,012	R143G	probably benign	Het
Patl2	T	A	2: 122,125,306	T250S	probably damaging	Het
Pcdhac2	C	T	18: 37,145,899	T644I	possibly damaging	Het
Pi4kb	C	T	3: 95,004,338	T690I	probably damaging	Het
Pla2g4d	T	C	2: 120,266,790	Y776C	probably benign	Het
Plekhh2	C	T	17: 84,563,959	S215L	probably benign	Het
Psmd2	T	G	16: 20,659,815		probably benign	Het
Ptprg	T	A	14: 12,226,314	D527E	probably damaging	Het
Rhobtb1	T	A	10: 69,279,497		probably null	Het
Scel	T	A	14: 103,572,037	M271K	possibly damaging	Het
Senp3	A	T	11: 69,678,829	C310*	probably null	Het
Slc25a3	T	C	10: 91,122,188	T97A	possibly damaging	Het
Srsf11	A	T	3: 158,026,732	Y82*	probably null	Het
Tbc1d8	G	A	1: 39,402,878	T211I	possibly damaging	Het
Tbkbp1	T	C	11: 97,148,648	E145G	probably damaging	Het
Tln1	T	C	4: 43,540,588	N1471S	probably benign	Het
Tnn	T	G	1: 160,146,089	D236A	probably damaging	Het
Trmt2a	C	T	16: 18,251,286		probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ubxn10	G	A	4: 138,735,948		probably benign	Het
Ulk4	G	A	9: 121,073,872	Q1180*	probably null	Het
Usp43	T	A	11: 67,855,505	K1120N	probably damaging	Het
Uspl1	T	A	5: 149,194,339	L244Q	possibly damaging	Het
Vmn1r32	T	C	6: 66,553,645	H49R	probably damaging	Het
Vmn2r4	T	C	3: 64,409,963	D118G	probably damaging	Het
Vwce	A	G	19: 10,650,579	I468V	probably benign	Het
Zbtb7c	G	T	18: 76,146,154	R561L	probably benign	Het
Zfp956	T	C	6: 47,962,542	S175P	probably damaging	Het

Other mutations in Ptpn21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Ptpn21	APN	12	98680468	missense	probably damaging	1.00
IGL00576:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00577:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00580:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00583:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00773:Ptpn21	APN	12	98688313	missense	probably benign	0.00
IGL00780:Ptpn21	APN	12	98680371	missense	probably damaging	1.00
IGL01516:Ptpn21	APN	12	98715189	missense	probably damaging	1.00
IGL01616:Ptpn21	APN	12	98680013	missense	probably damaging	1.00
IGL01939:Ptpn21	APN	12	98689161	missense	probably damaging	0.96
IGL02237:Ptpn21	APN	12	98705092	critical splice donor site	probably null
IGL02512:Ptpn21	APN	12	98679392	missense	probably benign	0.00
IGL02852:Ptpn21	APN	12	98715195	critical splice acceptor site	probably null
IGL02894:Ptpn21	APN	12	98689632	splice site	probably benign
IGL03024:Ptpn21	APN	12	98680056	missense	probably benign
IGL03220:Ptpn21	APN	12	98678623	missense	probably damaging	1.00
R0144:Ptpn21	UTSW	12	98688609	missense	probably benign	0.01
R0472:Ptpn21	UTSW	12	98704240	splice site	probably benign
R0675:Ptpn21	UTSW	12	98688216	missense	probably benign	0.16
R0771:Ptpn21	UTSW	12	98689080	missense	probably damaging	1.00
R1434:Ptpn21	UTSW	12	98688590	missense	probably damaging	1.00
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1837:Ptpn21	UTSW	12	98733626	missense	probably damaging	0.99
R1897:Ptpn21	UTSW	12	98680405	splice site	probably null
R2048:Ptpn21	UTSW	12	98689526	missense	possibly damaging	0.94
R2376:Ptpn21	UTSW	12	98688314	missense	possibly damaging	0.62
R3709:Ptpn21	UTSW	12	98688541	missense	probably benign
R4197:Ptpn21	UTSW	12	98680138	missense	probably damaging	1.00
R4283:Ptpn21	UTSW	12	98733475	missense	probably damaging	0.99
R4368:Ptpn21	UTSW	12	98678593	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98688248	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98715060	missense	probably damaging	0.98
R4703:Ptpn21	UTSW	12	98679392	missense	probably benign	0.00
R4829:Ptpn21	UTSW	12	98689296	missense	probably damaging	1.00
R4926:Ptpn21	UTSW	12	98715195	critical splice acceptor site	probably null
R4974:Ptpn21	UTSW	12	98680103	missense	probably damaging	1.00
R5022:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5057:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5395:Ptpn21	UTSW	12	98715117	missense	probably damaging	1.00
R5608:Ptpn21	UTSW	12	98688777	missense	probably benign	0.00
R5741:Ptpn21	UTSW	12	98679289	missense	probably damaging	1.00
R5785:Ptpn21	UTSW	12	98682550	missense	probably damaging	0.99
R5959:Ptpn21	UTSW	12	98708889	splice site	probably null
R5968:Ptpn21	UTSW	12	98710890	missense	probably damaging	1.00
R5984:Ptpn21	UTSW	12	98689076	missense	probably damaging	1.00
R6005:Ptpn21	UTSW	12	98678552	makesense	probably null
R6181:Ptpn21	UTSW	12	98699999	missense	probably damaging	0.99
R6226:Ptpn21	UTSW	12	98680116	missense	probably benign	0.24
R6226:Ptpn21	UTSW	12	98715172	missense	probably damaging	1.00
R6317:Ptpn21	UTSW	12	98689262	missense	probably damaging	1.00
R6370:Ptpn21	UTSW	12	98689034	missense	possibly damaging	0.86
R6485:Ptpn21	UTSW	12	98698872	nonsense	probably null
R6894:Ptpn21	UTSW	12	98715181	missense	probably damaging	1.00
R7122:Ptpn21	UTSW	12	98688912	missense	probably damaging	0.99
R7232:Ptpn21	UTSW	12	98688737	missense	probably benign	0.17
R7289:Ptpn21	UTSW	12	98704191	missense	probably benign	0.35
R7327:Ptpn21	UTSW	12	98680101	missense	probably damaging	1.00
R7474:Ptpn21	UTSW	12	98737363	critical splice donor site	probably null
R7748:Ptpn21	UTSW	12	98688772	missense	probably benign	0.01
R7816:Ptpn21	UTSW	12	98682532	missense	probably damaging	1.00
R7867:Ptpn21	UTSW	12	98705176	missense	probably damaging	1.00
R7878:Ptpn21	UTSW	12	98715128	missense	probably damaging	1.00
R7911:Ptpn21	UTSW	12	98688842	missense	probably damaging	0.99
R8100:Ptpn21	UTSW	12	98682622	missense	possibly damaging	0.61
R8199:Ptpn21	UTSW	12	98678582	missense	possibly damaging	0.92
R8272:Ptpn21	UTSW	12	98688530	missense	probably benign
R8481:Ptpn21	UTSW	12	98688894	missense	probably benign	0.03
R8535:Ptpn21	UTSW	12	98680026	missense	probably damaging	0.98
R8775:Ptpn21	UTSW	12	98682742	critical splice acceptor site	probably null
R8775-TAIL:Ptpn21	UTSW	12	98682742	critical splice acceptor site	probably null
R8929:Ptpn21	UTSW	12	98689137	missense	probably damaging	0.99
R8969:Ptpn21	UTSW	12	98689025	missense	probably benign	0.39
R9189:Ptpn21	UTSW	12	98689002	missense	probably damaging	1.00
R9781:Ptpn21	UTSW	12	98688911	missense	probably damaging	1.00
Z1177:Ptpn21	UTSW	12	98688458	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CCATTGGTACATGGACAATAACG -3'
(R):5'- TTCCTTAGACGCAGCATGGC -3'

Sequencing Primer
(F):5'- GCACTTACTTAGAACAGTACTTGGC -3'
(R):5'- CAGCATGGCCAGGTACAG -3'

Posted On

2015-11-11