Mutagenetix > Incidental Mutation

Incidental Mutation 'R2444:Wdr60'

249928

Institutional Source

Beutler Lab

Gene Symbol

Wdr60

Ensembl Gene

ENSMUSG00000042050

Gene Name

WD repeat domain 60

Synonyms

D430033N04Rik

MMRRC Submission

040402-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2444 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116206262-116263022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116232669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 486 (D486G)

Ref Sequence

ENSEMBL: ENSMUSP00000047334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039349]

AlphaFold

Q8C761

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039349
AA Change: D486G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: D486G

Domain	Start	End	E-Value	Type
coiled coil region	84	122	N/A	INTRINSIC
low complexity region	168	193	N/A	INTRINSIC
low complexity region	226	242	N/A	INTRINSIC
coiled coil region	280	309	N/A	INTRINSIC
low complexity region	319	337	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
WD40	629	668	2.77e-1	SMART
Blast:WD40	694	755	2e-7	BLAST
WD40	846	881	3.84e0	SMART
WD40	884	926	5.55e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222764

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	A	T	10: 79,068,727	D112E	possibly damaging	Het
4833427G06Rik	A	G	9: 51,099,998		probably null	Het
Abca15	A	G	7: 120,365,897	Y794C	probably damaging	Het
Bicd2	T	C	13: 49,379,024	V362A	probably benign	Het
Cep126	G	A	9: 8,101,306	T409M	probably damaging	Het
Cep131	A	G	11: 120,070,495	F610S	probably damaging	Het
Cfap61	T	C	2: 146,035,319		probably null	Het
Chd1l	A	G	3: 97,590,566	Y320H	probably damaging	Het
Dnajc30	A	G	5: 135,064,585	D112G	probably damaging	Het
Fam184a	A	C	10: 53,640,949	L410R	probably damaging	Het
Fat2	T	C	11: 55,281,973	N2638S	probably damaging	Het
Fgf15	A	G	7: 144,899,692	D134G	probably benign	Het
Flywch2	A	T	17: 23,777,050	S124R	possibly damaging	Het
Gabra5	G	A	7: 57,408,875	T375I	probably benign	Het
Gpat3	C	T	5: 100,857,173	P58L	probably benign	Het
Hltf	T	A	3: 20,063,907	N44K	possibly damaging	Het
Kcnb2	A	T	1: 15,709,567	N221I	probably benign	Het
Marco	G	A	1: 120,494,770	T61M	probably damaging	Het
Med13	A	G	11: 86,331,960	I180T	probably damaging	Het
Mei1	C	T	15: 82,112,941	T626M	probably damaging	Het
Mtnr1a	C	T	8: 45,087,658	Q219*	probably null	Het
Nav3	A	G	10: 109,764,915	S1284P	probably benign	Het
Olfr338	T	C	2: 36,377,613	V279A	possibly damaging	Het
Olfr849	T	A	9: 19,441,015	I34K	possibly damaging	Het
Pcdh9	T	A	14: 93,886,791	T648S	probably benign	Het
Proz	A	T	8: 13,061,027		probably benign	Het
Rec114	G	T	9: 58,660,319	A128E	probably damaging	Het
Rspry1	G	T	8: 94,623,107	G41V	probably damaging	Het
Sbf2	A	T	7: 110,330,698	M1388K	probably benign	Het
Spice1	C	T	16: 44,366,568	Q143*	probably null	Het
Tcstv3	A	T	13: 120,317,829	K88M	probably damaging	Het
Terb2	T	A	2: 122,193,307		probably null	Het
Tmx3	A	T	18: 90,540,183	K453M	probably damaging	Het
Tnc	T	C	4: 64,014,963	Y688C	probably damaging	Het
Tshz2	T	G	2: 169,884,806	S441A	probably benign	Het
Usp45	A	T	4: 21,817,528	M399L	probably benign	Het
Vmn2r82	A	T	10: 79,377,868	H96L	possibly damaging	Het
Wls	G	A	3: 159,907,230	R261Q	probably damaging	Het

Other mutations in Wdr60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Wdr60	APN	12	116241780	missense	probably benign	0.01
IGL00668:Wdr60	APN	12	116257428	missense	probably benign	0.32
IGL00914:Wdr60	APN	12	116232603	missense	probably damaging	1.00
IGL01061:Wdr60	APN	12	116229704	missense	probably benign	0.45
IGL01375:Wdr60	APN	12	116229676	missense	possibly damaging	0.91
IGL01758:Wdr60	APN	12	116218798	missense	possibly damaging	0.82
IGL01930:Wdr60	APN	12	116225963	critical splice donor site	probably null
IGL02028:Wdr60	APN	12	116256061	missense	probably benign	0.06
IGL03180:Wdr60	APN	12	116218865	missense	probably benign	0.07
F5770:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
R0153:Wdr60	UTSW	12	116232636	missense	probably benign	0.01
R0265:Wdr60	UTSW	12	116257406	splice site	probably benign
R0364:Wdr60	UTSW	12	116257477	splice site	probably benign
R0601:Wdr60	UTSW	12	116255935	missense	possibly damaging	0.79
R0624:Wdr60	UTSW	12	116248290	missense	probably damaging	0.98
R0755:Wdr60	UTSW	12	116211792	missense	probably benign	0.01
R1023:Wdr60	UTSW	12	116232657	missense	probably damaging	1.00
R1065:Wdr60	UTSW	12	116256076	missense	probably damaging	0.98
R1543:Wdr60	UTSW	12	116231784	splice site	probably benign
R1663:Wdr60	UTSW	12	116229610	missense	probably benign	0.01
R1678:Wdr60	UTSW	12	116225970	missense	probably damaging	1.00
R1719:Wdr60	UTSW	12	116255912	missense	probably benign
R1755:Wdr60	UTSW	12	116226029	missense	probably damaging	0.98
R1832:Wdr60	UTSW	12	116207743	missense	probably damaging	0.99
R1918:Wdr60	UTSW	12	116232601	missense	probably damaging	0.96
R2291:Wdr60	UTSW	12	116229571	splice site	probably null
R3419:Wdr60	UTSW	12	116224977	missense	probably benign	0.05
R3699:Wdr60	UTSW	12	116211842	nonsense	probably null
R3700:Wdr60	UTSW	12	116211842	nonsense	probably null
R4445:Wdr60	UTSW	12	116207715	missense	probably damaging	1.00
R4664:Wdr60	UTSW	12	116256211	missense	probably damaging	0.99
R4954:Wdr60	UTSW	12	116256025	missense	probably damaging	1.00
R5057:Wdr60	UTSW	12	116213413	missense	probably benign	0.43
R5163:Wdr60	UTSW	12	116255866	missense	possibly damaging	0.76
R5341:Wdr60	UTSW	12	116255914	missense	possibly damaging	0.51
R5560:Wdr60	UTSW	12	116218113	missense	probably damaging	0.98
R5870:Wdr60	UTSW	12	116256245	missense	possibly damaging	0.94
R5925:Wdr60	UTSW	12	116233394	missense	possibly damaging	0.82
R6223:Wdr60	UTSW	12	116257458	missense	possibly damaging	0.95
R6364:Wdr60	UTSW	12	116241732	missense	probably damaging	1.00
R6450:Wdr60	UTSW	12	116246727	nonsense	probably null
R6462:Wdr60	UTSW	12	116229631	missense	probably benign
R6751:Wdr60	UTSW	12	116213456	missense	possibly damaging	0.52
R6896:Wdr60	UTSW	12	116229671	missense	possibly damaging	0.52
R6962:Wdr60	UTSW	12	116211778	missense	probably damaging	1.00
R7033:Wdr60	UTSW	12	116211891	missense	probably benign	0.03
R7042:Wdr60	UTSW	12	116254441	missense	probably benign	0.02
R7254:Wdr60	UTSW	12	116262585	intron	probably benign
R7567:Wdr60	UTSW	12	116254510	splice site	probably null
R7889:Wdr60	UTSW	12	116255939	nonsense	probably null
R8082:Wdr60	UTSW	12	116213507	critical splice acceptor site	probably null
R8288:Wdr60	UTSW	12	116213725	missense	probably damaging	1.00
R8309:Wdr60	UTSW	12	116256085	missense	probably damaging	1.00
R8682:Wdr60	UTSW	12	116224990	missense	probably damaging	1.00
R8683:Wdr60	UTSW	12	116229642	missense	probably benign	0.03
R8699:Wdr60	UTSW	12	116207701	missense	probably benign	0.01
R8782:Wdr60	UTSW	12	116241712	missense	probably damaging	1.00
R8809:Wdr60	UTSW	12	116229614	missense	probably damaging	0.98
R9281:Wdr60	UTSW	12	116248057	nonsense	probably null
R9530:Wdr60	UTSW	12	116211791	missense	possibly damaging	0.87
R9751:Wdr60	UTSW	12	116241783	critical splice acceptor site	probably null
V7581:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7582:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7583:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
X0063:Wdr60	UTSW	12	116255869	missense	probably benign
Z1177:Wdr60	UTSW	12	116246099	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CAACAGCTCTGATCTCATTCATG -3'
(R):5'- TTGGTACAGATGACAGGTCCTTAG -3'

Sequencing Primer
(F):5'- AAAAGGTTACTTCCACAGTCATATAC -3'
(R):5'- AGCTGCGTGCATAGTCATAC -3'

Posted On

2014-11-12