Incidental Mutation 'R1719:Wdr60'
ID 191318
Institutional Source Beutler Lab
Gene Symbol Wdr60
Ensembl Gene ENSMUSG00000042050
Gene Name WD repeat domain 60
Synonyms D430033N04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1719 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 116206262-116263022 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116255912 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 137 (I137V)
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349] [ENSMUST00000222679]
AlphaFold Q8C761
Predicted Effect probably benign
Transcript: ENSMUST00000039349
AA Change: I137V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: I137V

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221029
Predicted Effect probably benign
Transcript: ENSMUST00000222679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223039
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,248,206 M459K probably damaging Het
A1cf A T 19: 31,927,126 K263M probably damaging Het
Adam26a G A 8: 43,570,036 T139M possibly damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap9 C T 5: 3,957,645 Q238* probably null Het
Ankrd6 A T 4: 32,828,774 V85E probably damaging Het
Ap2b1 C A 11: 83,324,604 P125T probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cblc A T 7: 19,790,474 D280E probably benign Het
Cdk11b T C 4: 155,648,397 probably benign Het
Cela2a G T 4: 141,817,946 F239L probably damaging Het
Cfap57 A T 4: 118,606,631 C342S probably benign Het
Clca4a C A 3: 144,963,755 W345L probably damaging Het
Col6a5 T C 9: 105,931,293 D852G unknown Het
Cyp4a32 T C 4: 115,611,308 V329A possibly damaging Het
Dcaf8 C T 1: 172,175,495 P287S probably damaging Het
Dmxl1 T A 18: 49,934,637 D2654E probably damaging Het
Dpep1 A T 8: 123,200,747 I347F possibly damaging Het
Dtnb T A 12: 3,643,936 Y56* probably null Het
Duox1 T C 2: 122,338,644 Y1182H possibly damaging Het
Dusp10 T A 1: 184,037,225 S129R probably benign Het
Epcam G A 17: 87,642,128 R173Q probably damaging Het
Ephb3 A G 16: 21,220,650 E384G probably damaging Het
Exosc10 A T 4: 148,568,503 D525V probably damaging Het
Fam186a T A 15: 99,942,346 T2006S possibly damaging Het
Fbxw21 T A 9: 109,148,174 T156S possibly damaging Het
Fcrl5 A G 3: 87,457,397 E568G probably damaging Het
Fmn2 C T 1: 174,608,458 probably benign Het
Fut9 A G 4: 25,619,744 F357L possibly damaging Het
Gas2l1 G A 11: 5,064,266 H65Y probably damaging Het
Gjd2 A T 2: 114,013,133 M1K probably null Het
Gm12169 T C 11: 46,526,294 L13P probably damaging Het
Gm884 T A 11: 103,617,071 probably benign Het
Hdgfl3 T C 7: 81,899,684 Y149C probably damaging Het
Hmcn2 T C 2: 31,354,721 V730A probably damaging Het
Inpp4a A T 1: 37,398,799 S223C probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Knl1 T A 2: 119,071,738 W1307R probably benign Het
Kpna3 A G 14: 61,387,477 L139P probably damaging Het
Lama3 T C 18: 12,479,872 probably null Het
Lin54 G A 5: 100,485,249 P192L possibly damaging Het
Lpo T A 11: 87,809,192 probably null Het
Lrrd1 T G 5: 3,850,483 probably null Het
Nbas T A 12: 13,560,977 probably null Het
Nemp1 G A 10: 127,696,248 G341D probably damaging Het
Nrp1 T C 8: 128,425,885 F192L probably damaging Het
Nufip2 T A 11: 77,693,090 V610E probably damaging Het
Nup160 T G 2: 90,700,436 Y479* probably null Het
Oas1d A T 5: 120,919,962 D323V possibly damaging Het
Olfr125 A G 17: 37,835,353 D118G possibly damaging Het
Olfr1338 A G 4: 118,753,600 W315R possibly damaging Het
Olfr140 T C 2: 90,051,784 Y180C probably damaging Het
Olfr147 G A 9: 38,403,254 V127M possibly damaging Het
Olfr204 T A 16: 59,314,706 R234* probably null Het
Olfr25 A T 9: 38,330,507 T307S probably benign Het
Olfr677 C A 7: 105,056,794 H183N probably damaging Het
Pcm1 T A 8: 41,313,359 M1567K possibly damaging Het
Pdxk A G 10: 78,443,896 V215A probably benign Het
Phf12 T A 11: 78,023,601 L74Q probably damaging Het
Plcg1 A G 2: 160,753,743 E537G probably null Het
Plxna2 C T 1: 194,644,370 P204L possibly damaging Het
Ppp3cb T G 14: 20,524,063 M236L probably benign Het
Qrsl1 A T 10: 43,896,030 S55T probably damaging Het
Rbm5 T C 9: 107,743,913 probably null Het
Sipa1l2 A G 8: 125,444,535 S1403P probably damaging Het
Sis C T 3: 72,965,604 C67Y probably damaging Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Speg G A 1: 75,417,863 E1739K probably benign Het
Sprtn C A 8: 124,901,633 H154Q probably damaging Het
St7l A G 3: 104,870,987 T147A probably benign Het
Stab1 G A 14: 31,146,028 Q1630* probably null Het
Stpg2 A G 3: 139,232,199 D173G probably benign Het
Tcf20 G A 15: 82,852,777 T1491I probably benign Het
Themis2 A T 4: 132,789,649 I180N possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn C T 2: 76,745,634 V24972M probably damaging Het
Ttn A G 2: 76,807,996 V13980A probably damaging Het
Usp5 A T 6: 124,823,460 M286K possibly damaging Het
Vmn2r22 G A 6: 123,637,843 R263C possibly damaging Het
Vmn2r71 T G 7: 85,621,227 C534G probably damaging Het
Wnk2 C T 13: 49,060,726 S1460N possibly damaging Het
Zfp445 G A 9: 122,852,642 P745S probably damaging Het
Zfp957 C T 14: 79,213,996 G121D probably damaging Het
Zscan4f A G 7: 11,401,327 E220G possibly damaging Het
Other mutations in Wdr60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Wdr60 APN 12 116241780 missense probably benign 0.01
IGL00668:Wdr60 APN 12 116257428 missense probably benign 0.32
IGL00914:Wdr60 APN 12 116232603 missense probably damaging 1.00
IGL01061:Wdr60 APN 12 116229704 missense probably benign 0.45
IGL01375:Wdr60 APN 12 116229676 missense possibly damaging 0.91
IGL01758:Wdr60 APN 12 116218798 missense possibly damaging 0.82
IGL01930:Wdr60 APN 12 116225963 critical splice donor site probably null
IGL02028:Wdr60 APN 12 116256061 missense probably benign 0.06
IGL03180:Wdr60 APN 12 116218865 missense probably benign 0.07
F5770:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
R0153:Wdr60 UTSW 12 116232636 missense probably benign 0.01
R0265:Wdr60 UTSW 12 116257406 splice site probably benign
R0364:Wdr60 UTSW 12 116257477 splice site probably benign
R0601:Wdr60 UTSW 12 116255935 missense possibly damaging 0.79
R0624:Wdr60 UTSW 12 116248290 missense probably damaging 0.98
R0755:Wdr60 UTSW 12 116211792 missense probably benign 0.01
R1023:Wdr60 UTSW 12 116232657 missense probably damaging 1.00
R1065:Wdr60 UTSW 12 116256076 missense probably damaging 0.98
R1543:Wdr60 UTSW 12 116231784 splice site probably benign
R1663:Wdr60 UTSW 12 116229610 missense probably benign 0.01
R1678:Wdr60 UTSW 12 116225970 missense probably damaging 1.00
R1755:Wdr60 UTSW 12 116226029 missense probably damaging 0.98
R1832:Wdr60 UTSW 12 116207743 missense probably damaging 0.99
R1918:Wdr60 UTSW 12 116232601 missense probably damaging 0.96
R2291:Wdr60 UTSW 12 116229571 splice site probably null
R2444:Wdr60 UTSW 12 116232669 missense possibly damaging 0.93
R3419:Wdr60 UTSW 12 116224977 missense probably benign 0.05
R3699:Wdr60 UTSW 12 116211842 nonsense probably null
R3700:Wdr60 UTSW 12 116211842 nonsense probably null
R4445:Wdr60 UTSW 12 116207715 missense probably damaging 1.00
R4664:Wdr60 UTSW 12 116256211 missense probably damaging 0.99
R4954:Wdr60 UTSW 12 116256025 missense probably damaging 1.00
R5057:Wdr60 UTSW 12 116213413 missense probably benign 0.43
R5163:Wdr60 UTSW 12 116255866 missense possibly damaging 0.76
R5341:Wdr60 UTSW 12 116255914 missense possibly damaging 0.51
R5560:Wdr60 UTSW 12 116218113 missense probably damaging 0.98
R5870:Wdr60 UTSW 12 116256245 missense possibly damaging 0.94
R5925:Wdr60 UTSW 12 116233394 missense possibly damaging 0.82
R6223:Wdr60 UTSW 12 116257458 missense possibly damaging 0.95
R6364:Wdr60 UTSW 12 116241732 missense probably damaging 1.00
R6450:Wdr60 UTSW 12 116246727 nonsense probably null
R6462:Wdr60 UTSW 12 116229631 missense probably benign
R6751:Wdr60 UTSW 12 116213456 missense possibly damaging 0.52
R6896:Wdr60 UTSW 12 116229671 missense possibly damaging 0.52
R6962:Wdr60 UTSW 12 116211778 missense probably damaging 1.00
R7033:Wdr60 UTSW 12 116211891 missense probably benign 0.03
R7042:Wdr60 UTSW 12 116254441 missense probably benign 0.02
R7254:Wdr60 UTSW 12 116262585 intron probably benign
R7567:Wdr60 UTSW 12 116254510 splice site probably null
R7889:Wdr60 UTSW 12 116255939 nonsense probably null
R8082:Wdr60 UTSW 12 116213507 critical splice acceptor site probably null
R8288:Wdr60 UTSW 12 116213725 missense probably damaging 1.00
R8309:Wdr60 UTSW 12 116256085 missense probably damaging 1.00
R8682:Wdr60 UTSW 12 116224990 missense probably damaging 1.00
R8683:Wdr60 UTSW 12 116229642 missense probably benign 0.03
R8699:Wdr60 UTSW 12 116207701 missense probably benign 0.01
R8782:Wdr60 UTSW 12 116241712 missense probably damaging 1.00
R8809:Wdr60 UTSW 12 116229614 missense probably damaging 0.98
R9281:Wdr60 UTSW 12 116248057 nonsense probably null
R9530:Wdr60 UTSW 12 116211791 missense possibly damaging 0.87
R9751:Wdr60 UTSW 12 116241783 critical splice acceptor site probably null
V7581:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7582:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
V7583:Wdr60 UTSW 12 116211840 missense possibly damaging 0.73
X0063:Wdr60 UTSW 12 116255869 missense probably benign
Z1177:Wdr60 UTSW 12 116246099 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACACACATTCACACAGGAGCAG -3'
(R):5'- GTGCAGTCAGGCAGTCCCAAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GCTGAGAGAGACCTGTACACC -3'
Posted On 2014-05-14