Mutagenetix > Incidental Mutation

Incidental Mutation 'R9751:Wdr60'

732535

Institutional Source

Beutler Lab

Gene Symbol

Wdr60

Ensembl Gene

ENSMUSG00000042050

Gene Name

WD repeat domain 60

Synonyms

D430033N04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9751 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116206262-116263022 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 116241783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000047334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039349] [ENSMUST00000039349] [ENSMUST00000039349]

AlphaFold

Q8C761

Predicted Effect

probably null
Transcript: ENSMUST00000039349

SMART Domains

Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050

Domain	Start	End	E-Value	Type
coiled coil region	84	122	N/A	INTRINSIC
low complexity region	168	193	N/A	INTRINSIC
low complexity region	226	242	N/A	INTRINSIC
coiled coil region	280	309	N/A	INTRINSIC
low complexity region	319	337	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
WD40	629	668	2.77e-1	SMART
Blast:WD40	694	755	2e-7	BLAST
WD40	846	881	3.84e0	SMART
WD40	884	926	5.55e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000039349

SMART Domains

Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050

Domain	Start	End	E-Value	Type
coiled coil region	84	122	N/A	INTRINSIC
low complexity region	168	193	N/A	INTRINSIC
low complexity region	226	242	N/A	INTRINSIC
coiled coil region	280	309	N/A	INTRINSIC
low complexity region	319	337	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
WD40	629	668	2.77e-1	SMART
Blast:WD40	694	755	2e-7	BLAST
WD40	846	881	3.84e0	SMART
WD40	884	926	5.55e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000039349

SMART Domains

Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050

Domain	Start	End	E-Value	Type
coiled coil region	84	122	N/A	INTRINSIC
low complexity region	168	193	N/A	INTRINSIC
low complexity region	226	242	N/A	INTRINSIC
coiled coil region	280	309	N/A	INTRINSIC
low complexity region	319	337	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
WD40	629	668	2.77e-1	SMART
Blast:WD40	694	755	2e-7	BLAST
WD40	846	881	3.84e0	SMART
WD40	884	926	5.55e-1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 37,011,740	I54M		Het
Abca4	A	G	3: 122,087,477	N514D	probably benign	Het
Adgre1	G	A	17: 57,450,101	R786H	probably null	Het
Ankrd7	G	A	6: 18,868,025	V97I	probably damaging	Het
Bmper	C	T	9: 23,406,713	P543S	possibly damaging	Het
Brwd1	A	T	16: 95,993,815	M2233K	possibly damaging	Het
C1s2	G	T	6: 124,625,594	P553T	probably damaging	Het
Cachd1	G	A	4: 100,966,241	V497I	possibly damaging	Het
Cacng4	A	G	11: 107,735,193	S191P	probably damaging	Het
Cd109	C	A	9: 78,698,160	T1015K	probably damaging	Het
Clstn2	A	G	9: 97,457,650	L756P	probably damaging	Het
Crybg3	A	T	16: 59,557,524	D1122E	possibly damaging	Het
Csf2	A	T	11: 54,249,594	L6*	probably null	Het
Csnk1g2	T	A	10: 80,637,911	Y71N	possibly damaging	Het
Dlg2	C	A	7: 90,915,523	H116N	probably benign	Het
Dnah14	C	T	1: 181,792,045	S3978L	probably damaging	Het
Dpp8	C	T	9: 65,053,171	T328I	probably null	Het
Dysf	T	C	6: 84,186,468	V1625A	probably damaging	Het
Egf	C	A	3: 129,754,889	V26F	probably damaging	Het
Fam126a	C	T	5: 23,991,750	E47K	probably benign	Het
Fam20a	T	A	11: 109,675,166	Y414F	probably damaging	Het
Fsip2	T	C	2: 82,987,897	I4658T	probably benign	Het
Gm11639	G	A	11: 104,893,085	G2754E	probably benign	Het
Gm21319	T	C	12: 87,773,756	N11S	possibly damaging	Het
Igflr1	A	T	7: 30,567,228	Q167L	possibly damaging	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Map3k6	A	G	4: 133,251,857		probably null	Het
Mcpt4	A	G	14: 56,060,054	I215T	probably damaging	Het
Med13	T	C	11: 86,299,158	Y975C	probably damaging	Het
Meioc	T	A	11: 102,675,593	Y678*	probably null	Het
Myof	T	C	19: 37,936,370	T1190A	probably benign	Het
Nap1l4	A	C	7: 143,534,395		probably benign	Het
Ncapg	T	C	5: 45,693,853	V796A	probably damaging	Het
Olfr1167	T	A	2: 88,149,270	I250L	probably benign	Het
Olfr1168	T	A	2: 88,184,916	V13E	possibly damaging	Het
Olfr1224-ps1	C	T	2: 89,156,438	V246M	possibly damaging	Het
Olfr1257	C	T	2: 89,881,612	T262I	probably benign	Het
Olfr493	T	C	7: 108,346,438	Y181C	probably benign	Het
Paxbp1	A	G	16: 91,027,300	S515P	probably benign	Het
Plce1	C	T	19: 38,728,970	S1401F	probably damaging	Het
Rptor	A	G	11: 119,887,138	K1043E	probably benign	Het
Rtn4rl2	T	G	2: 84,880,695	N75T	probably damaging	Het
Slc35f4	A	G	14: 49,298,834	I448T	possibly damaging	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tas2r115	A	G	6: 132,737,955	I11T	possibly damaging	Het
Tbc1d5	A	G	17: 50,874,652	V351A	possibly damaging	Het
Tmem55b	A	G	14: 50,927,979	V257A	probably benign	Het
Trim43b	A	T	9: 89,089,517	D195E	probably benign	Het
Trim65	C	A	11: 116,130,738	A90S	probably benign	Het
Trip11	C	T	12: 101,884,506	V1100I	possibly damaging	Het
Tyrp1	A	G	4: 80,840,775	E295G	probably null	Het
Ube2g2	G	A	10: 77,644,473	V138I	probably benign	Het

Other mutations in Wdr60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Wdr60	APN	12	116241780	missense	probably benign	0.01
IGL00668:Wdr60	APN	12	116257428	missense	probably benign	0.32
IGL00914:Wdr60	APN	12	116232603	missense	probably damaging	1.00
IGL01061:Wdr60	APN	12	116229704	missense	probably benign	0.45
IGL01375:Wdr60	APN	12	116229676	missense	possibly damaging	0.91
IGL01758:Wdr60	APN	12	116218798	missense	possibly damaging	0.82
IGL01930:Wdr60	APN	12	116225963	critical splice donor site	probably null
IGL02028:Wdr60	APN	12	116256061	missense	probably benign	0.06
IGL03180:Wdr60	APN	12	116218865	missense	probably benign	0.07
F5770:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
R0153:Wdr60	UTSW	12	116232636	missense	probably benign	0.01
R0265:Wdr60	UTSW	12	116257406	splice site	probably benign
R0364:Wdr60	UTSW	12	116257477	splice site	probably benign
R0601:Wdr60	UTSW	12	116255935	missense	possibly damaging	0.79
R0624:Wdr60	UTSW	12	116248290	missense	probably damaging	0.98
R0755:Wdr60	UTSW	12	116211792	missense	probably benign	0.01
R1023:Wdr60	UTSW	12	116232657	missense	probably damaging	1.00
R1065:Wdr60	UTSW	12	116256076	missense	probably damaging	0.98
R1543:Wdr60	UTSW	12	116231784	splice site	probably benign
R1663:Wdr60	UTSW	12	116229610	missense	probably benign	0.01
R1678:Wdr60	UTSW	12	116225970	missense	probably damaging	1.00
R1719:Wdr60	UTSW	12	116255912	missense	probably benign
R1755:Wdr60	UTSW	12	116226029	missense	probably damaging	0.98
R1832:Wdr60	UTSW	12	116207743	missense	probably damaging	0.99
R1918:Wdr60	UTSW	12	116232601	missense	probably damaging	0.96
R2291:Wdr60	UTSW	12	116229571	splice site	probably null
R2444:Wdr60	UTSW	12	116232669	missense	possibly damaging	0.93
R3419:Wdr60	UTSW	12	116224977	missense	probably benign	0.05
R3699:Wdr60	UTSW	12	116211842	nonsense	probably null
R3700:Wdr60	UTSW	12	116211842	nonsense	probably null
R4445:Wdr60	UTSW	12	116207715	missense	probably damaging	1.00
R4664:Wdr60	UTSW	12	116256211	missense	probably damaging	0.99
R4954:Wdr60	UTSW	12	116256025	missense	probably damaging	1.00
R5057:Wdr60	UTSW	12	116213413	missense	probably benign	0.43
R5163:Wdr60	UTSW	12	116255866	missense	possibly damaging	0.76
R5341:Wdr60	UTSW	12	116255914	missense	possibly damaging	0.51
R5560:Wdr60	UTSW	12	116218113	missense	probably damaging	0.98
R5870:Wdr60	UTSW	12	116256245	missense	possibly damaging	0.94
R5925:Wdr60	UTSW	12	116233394	missense	possibly damaging	0.82
R6223:Wdr60	UTSW	12	116257458	missense	possibly damaging	0.95
R6364:Wdr60	UTSW	12	116241732	missense	probably damaging	1.00
R6450:Wdr60	UTSW	12	116246727	nonsense	probably null
R6462:Wdr60	UTSW	12	116229631	missense	probably benign
R6751:Wdr60	UTSW	12	116213456	missense	possibly damaging	0.52
R6896:Wdr60	UTSW	12	116229671	missense	possibly damaging	0.52
R6962:Wdr60	UTSW	12	116211778	missense	probably damaging	1.00
R7033:Wdr60	UTSW	12	116211891	missense	probably benign	0.03
R7042:Wdr60	UTSW	12	116254441	missense	probably benign	0.02
R7254:Wdr60	UTSW	12	116262585	intron	probably benign
R7567:Wdr60	UTSW	12	116254510	splice site	probably null
R7889:Wdr60	UTSW	12	116255939	nonsense	probably null
R8082:Wdr60	UTSW	12	116213507	critical splice acceptor site	probably null
R8288:Wdr60	UTSW	12	116213725	missense	probably damaging	1.00
R8309:Wdr60	UTSW	12	116256085	missense	probably damaging	1.00
R8682:Wdr60	UTSW	12	116224990	missense	probably damaging	1.00
R8683:Wdr60	UTSW	12	116229642	missense	probably benign	0.03
R8699:Wdr60	UTSW	12	116207701	missense	probably benign	0.01
R8782:Wdr60	UTSW	12	116241712	missense	probably damaging	1.00
R8809:Wdr60	UTSW	12	116229614	missense	probably damaging	0.98
R9281:Wdr60	UTSW	12	116248057	nonsense	probably null
R9530:Wdr60	UTSW	12	116211791	missense	possibly damaging	0.87
V7581:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7582:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
V7583:Wdr60	UTSW	12	116211840	missense	possibly damaging	0.73
X0063:Wdr60	UTSW	12	116255869	missense	probably benign
Z1177:Wdr60	UTSW	12	116246099	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGCCCTGAGTTTCATCCAC -3'
(R):5'- TGAGACCACAGGTGAGGTTTTG -3'

Sequencing Primer
(F):5'- GCCCTGAGTTTCATCCACAAACAC -3'
(R):5'- CCCCCAGAGTAAGTAGGATAATG -3'

Posted On

2022-11-14