Incidental Mutation 'R9751:Dync2i1'
ID 732535
Institutional Source Beutler Lab
Gene Symbol Dync2i1
Ensembl Gene ENSMUSG00000042050
Gene Name dynein 2 intermediate chain 1
Synonyms Dync2l1, D430033N04Rik, Wdr60
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9751 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116169882-116226642 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 116205403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349] [ENSMUST00000039349] [ENSMUST00000039349]
AlphaFold Q8C761
Predicted Effect probably null
Transcript: ENSMUST00000039349
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000039349
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000039349
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,881,126 (GRCm39) N514D probably benign Het
Adgre1 G A 17: 57,757,101 (GRCm39) R786H probably null Het
Ankrd7 G A 6: 18,868,024 (GRCm39) V97I probably damaging Het
Bltp1 A G 3: 37,065,889 (GRCm39) I54M Het
Bmper C T 9: 23,318,009 (GRCm39) P543S possibly damaging Het
Brwd1 A T 16: 95,795,015 (GRCm39) M2233K possibly damaging Het
C1s2 G T 6: 124,602,553 (GRCm39) P553T probably damaging Het
Cachd1 G A 4: 100,823,438 (GRCm39) V497I possibly damaging Het
Cacng4 A G 11: 107,626,019 (GRCm39) S191P probably damaging Het
Cd109 C A 9: 78,605,442 (GRCm39) T1015K probably damaging Het
Clstn2 A G 9: 97,339,703 (GRCm39) L756P probably damaging Het
Crybg3 A T 16: 59,377,887 (GRCm39) D1122E possibly damaging Het
Csf2 A T 11: 54,140,420 (GRCm39) L6* probably null Het
Csnk1g2 T A 10: 80,473,745 (GRCm39) Y71N possibly damaging Het
Dlg2 C A 7: 90,564,731 (GRCm39) H116N probably benign Het
Dnah14 C T 1: 181,619,610 (GRCm39) S3978L probably damaging Het
Dpp8 C T 9: 64,960,453 (GRCm39) T328I probably null Het
Dysf T C 6: 84,163,450 (GRCm39) V1625A probably damaging Het
Efcab3 G A 11: 104,783,911 (GRCm39) G2754E probably benign Het
Egf C A 3: 129,548,538 (GRCm39) V26F probably damaging Het
Eif1ad19 T C 12: 87,740,526 (GRCm39) N11S possibly damaging Het
Fam20a T A 11: 109,565,992 (GRCm39) Y414F probably damaging Het
Fsip2 T C 2: 82,818,241 (GRCm39) I4658T probably benign Het
Hycc1 C T 5: 24,196,748 (GRCm39) E47K probably benign Het
Igflr1 A T 7: 30,266,653 (GRCm39) Q167L possibly damaging Het
Krt79 T G 15: 101,839,196 (GRCm39) E424D probably benign Het
Map3k6 A G 4: 132,979,168 (GRCm39) probably null Het
Mcpt4 A G 14: 56,297,511 (GRCm39) I215T probably damaging Het
Med13 T C 11: 86,189,984 (GRCm39) Y975C probably damaging Het
Meioc T A 11: 102,566,419 (GRCm39) Y678* probably null Het
Myof T C 19: 37,924,818 (GRCm39) T1190A probably benign Het
Nap1l4 A C 7: 143,088,132 (GRCm39) probably benign Het
Ncapg T C 5: 45,851,195 (GRCm39) V796A probably damaging Het
Or4c10b C T 2: 89,711,956 (GRCm39) T262I probably benign Het
Or4c119 C T 2: 88,986,782 (GRCm39) V246M possibly damaging Het
Or5d39 T A 2: 87,979,614 (GRCm39) I250L probably benign Het
Or5d40 T A 2: 88,015,260 (GRCm39) V13E possibly damaging Het
Or5p68 T C 7: 107,945,645 (GRCm39) Y181C probably benign Het
Paxbp1 A G 16: 90,824,188 (GRCm39) S515P probably benign Het
Pip4p1 A G 14: 51,165,436 (GRCm39) V257A probably benign Het
Plce1 C T 19: 38,717,414 (GRCm39) S1401F probably damaging Het
Rptor A G 11: 119,777,964 (GRCm39) K1043E probably benign Het
Rtn4rl2 T G 2: 84,711,039 (GRCm39) N75T probably damaging Het
Slc35f4 A G 14: 49,536,291 (GRCm39) I448T possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tas2r115 A G 6: 132,714,918 (GRCm39) I11T possibly damaging Het
Tbc1d5 A G 17: 51,181,680 (GRCm39) V351A possibly damaging Het
Trim43b A T 9: 88,971,570 (GRCm39) D195E probably benign Het
Trim65 C A 11: 116,021,564 (GRCm39) A90S probably benign Het
Trip11 C T 12: 101,850,765 (GRCm39) V1100I possibly damaging Het
Tyrp1 A G 4: 80,759,012 (GRCm39) E295G probably null Het
Ube2g2 G A 10: 77,480,307 (GRCm39) V138I probably benign Het
Other mutations in Dync2i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dync2i1 APN 12 116,205,400 (GRCm39) missense probably benign 0.01
IGL00668:Dync2i1 APN 12 116,221,048 (GRCm39) missense probably benign 0.32
IGL00914:Dync2i1 APN 12 116,196,223 (GRCm39) missense probably damaging 1.00
IGL01061:Dync2i1 APN 12 116,193,324 (GRCm39) missense probably benign 0.45
IGL01375:Dync2i1 APN 12 116,193,296 (GRCm39) missense possibly damaging 0.91
IGL01758:Dync2i1 APN 12 116,182,418 (GRCm39) missense possibly damaging 0.82
IGL01930:Dync2i1 APN 12 116,189,583 (GRCm39) critical splice donor site probably null
IGL02028:Dync2i1 APN 12 116,219,681 (GRCm39) missense probably benign 0.06
IGL03180:Dync2i1 APN 12 116,182,485 (GRCm39) missense probably benign 0.07
F5770:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
R0153:Dync2i1 UTSW 12 116,196,256 (GRCm39) missense probably benign 0.01
R0265:Dync2i1 UTSW 12 116,221,026 (GRCm39) splice site probably benign
R0364:Dync2i1 UTSW 12 116,221,097 (GRCm39) splice site probably benign
R0601:Dync2i1 UTSW 12 116,219,555 (GRCm39) missense possibly damaging 0.79
R0624:Dync2i1 UTSW 12 116,211,910 (GRCm39) missense probably damaging 0.98
R0755:Dync2i1 UTSW 12 116,175,412 (GRCm39) missense probably benign 0.01
R1023:Dync2i1 UTSW 12 116,196,277 (GRCm39) missense probably damaging 1.00
R1065:Dync2i1 UTSW 12 116,219,696 (GRCm39) missense probably damaging 0.98
R1543:Dync2i1 UTSW 12 116,195,404 (GRCm39) splice site probably benign
R1663:Dync2i1 UTSW 12 116,193,230 (GRCm39) missense probably benign 0.01
R1678:Dync2i1 UTSW 12 116,189,590 (GRCm39) missense probably damaging 1.00
R1719:Dync2i1 UTSW 12 116,219,532 (GRCm39) missense probably benign
R1755:Dync2i1 UTSW 12 116,189,649 (GRCm39) missense probably damaging 0.98
R1832:Dync2i1 UTSW 12 116,171,363 (GRCm39) missense probably damaging 0.99
R1918:Dync2i1 UTSW 12 116,196,221 (GRCm39) missense probably damaging 0.96
R2291:Dync2i1 UTSW 12 116,193,191 (GRCm39) splice site probably null
R2444:Dync2i1 UTSW 12 116,196,289 (GRCm39) missense possibly damaging 0.93
R3419:Dync2i1 UTSW 12 116,188,597 (GRCm39) missense probably benign 0.05
R3699:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R3700:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R4445:Dync2i1 UTSW 12 116,171,335 (GRCm39) missense probably damaging 1.00
R4664:Dync2i1 UTSW 12 116,219,831 (GRCm39) missense probably damaging 0.99
R4954:Dync2i1 UTSW 12 116,219,645 (GRCm39) missense probably damaging 1.00
R5057:Dync2i1 UTSW 12 116,177,033 (GRCm39) missense probably benign 0.43
R5163:Dync2i1 UTSW 12 116,219,486 (GRCm39) missense possibly damaging 0.76
R5341:Dync2i1 UTSW 12 116,219,534 (GRCm39) missense possibly damaging 0.51
R5560:Dync2i1 UTSW 12 116,181,733 (GRCm39) missense probably damaging 0.98
R5870:Dync2i1 UTSW 12 116,219,865 (GRCm39) missense possibly damaging 0.94
R5925:Dync2i1 UTSW 12 116,197,014 (GRCm39) missense possibly damaging 0.82
R6223:Dync2i1 UTSW 12 116,221,078 (GRCm39) missense possibly damaging 0.95
R6364:Dync2i1 UTSW 12 116,205,352 (GRCm39) missense probably damaging 1.00
R6450:Dync2i1 UTSW 12 116,210,347 (GRCm39) nonsense probably null
R6462:Dync2i1 UTSW 12 116,193,251 (GRCm39) missense probably benign
R6751:Dync2i1 UTSW 12 116,177,076 (GRCm39) missense possibly damaging 0.52
R6896:Dync2i1 UTSW 12 116,193,291 (GRCm39) missense possibly damaging 0.52
R6962:Dync2i1 UTSW 12 116,175,398 (GRCm39) missense probably damaging 1.00
R7033:Dync2i1 UTSW 12 116,175,511 (GRCm39) missense probably benign 0.03
R7042:Dync2i1 UTSW 12 116,218,061 (GRCm39) missense probably benign 0.02
R7254:Dync2i1 UTSW 12 116,226,205 (GRCm39) intron probably benign
R7567:Dync2i1 UTSW 12 116,218,130 (GRCm39) splice site probably null
R7889:Dync2i1 UTSW 12 116,219,559 (GRCm39) nonsense probably null
R8082:Dync2i1 UTSW 12 116,177,127 (GRCm39) critical splice acceptor site probably null
R8288:Dync2i1 UTSW 12 116,177,345 (GRCm39) missense probably damaging 1.00
R8309:Dync2i1 UTSW 12 116,219,705 (GRCm39) missense probably damaging 1.00
R8682:Dync2i1 UTSW 12 116,188,610 (GRCm39) missense probably damaging 1.00
R8683:Dync2i1 UTSW 12 116,193,262 (GRCm39) missense probably benign 0.03
R8699:Dync2i1 UTSW 12 116,171,321 (GRCm39) missense probably benign 0.01
R8782:Dync2i1 UTSW 12 116,205,332 (GRCm39) missense probably damaging 1.00
R8809:Dync2i1 UTSW 12 116,193,234 (GRCm39) missense probably damaging 0.98
R9281:Dync2i1 UTSW 12 116,211,677 (GRCm39) nonsense probably null
R9530:Dync2i1 UTSW 12 116,175,411 (GRCm39) missense possibly damaging 0.87
V7581:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7582:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7583:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
X0063:Dync2i1 UTSW 12 116,219,489 (GRCm39) missense probably benign
Z1177:Dync2i1 UTSW 12 116,209,719 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCCCTGAGTTTCATCCAC -3'
(R):5'- TGAGACCACAGGTGAGGTTTTG -3'

Sequencing Primer
(F):5'- GCCCTGAGTTTCATCCACAAACAC -3'
(R):5'- CCCCCAGAGTAAGTAGGATAATG -3'
Posted On 2022-11-14