Incidental Mutation 'R2471:4930563M21Rik'
ID253096
Institutional Source Beutler Lab
Gene Symbol 4930563M21Rik
Ensembl Gene ENSMUSG00000050702
Gene NameRIKEN cDNA 4930563M21 gene
SynonymsRfpl3s
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location55962589-56010550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55980863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 390 (M390K)
Ref Sequence ENSEMBL: ENSMUSP00000150879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060468] [ENSMUST00000217105]
Predicted Effect probably benign
Transcript: ENSMUST00000060468
AA Change: M9K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000051794
Gene: ENSMUSG00000050702
AA Change: M9K

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217105
AA Change: M390K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in 4930563M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02721:4930563M21Rik APN 9 55980840 missense probably benign 0.14
R3831:4930563M21Rik UTSW 9 55973708 missense unknown
R4237:4930563M21Rik UTSW 9 55980842 missense probably benign 0.29
R4238:4930563M21Rik UTSW 9 55980842 missense probably benign 0.29
R4239:4930563M21Rik UTSW 9 55980842 missense probably benign 0.29
R5412:4930563M21Rik UTSW 9 55978752 missense probably damaging 0.97
R6191:4930563M21Rik UTSW 9 56002523 missense possibly damaging 0.81
R6368:4930563M21Rik UTSW 9 55990132 missense possibly damaging 0.46
R6415:4930563M21Rik UTSW 9 55974012 missense probably benign 0.00
R6700:4930563M21Rik UTSW 9 55973856 missense unknown
R6727:4930563M21Rik UTSW 9 55989476 missense possibly damaging 0.46
R7346:4930563M21Rik UTSW 9 56007303 missense unknown
R7470:4930563M21Rik UTSW 9 55991338 missense possibly damaging 0.68
R7499:4930563M21Rik UTSW 9 55999902 missense possibly damaging 0.49
R7609:4930563M21Rik UTSW 9 55989460 missense probably benign 0.00
R7616:4930563M21Rik UTSW 9 55989454 missense probably benign 0.03
R7662:4930563M21Rik UTSW 9 55978715 missense probably benign 0.00
R8018:4930563M21Rik UTSW 9 55973707 missense unknown
R8057:4930563M21Rik UTSW 9 56009280 missense unknown
R8077:4930563M21Rik UTSW 9 55987966 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGTCGTCCAGTGAGAACCAC -3'
(R):5'- GGTGCCTGTCATCTTCAAGAATAC -3'

Sequencing Primer
(F):5'- TGTACTGGGGGAACAAACTTGTC -3'
(R):5'- CCTGTCATCTTCAAGAATACTGAATC -3'
Posted On2014-12-04