Incidental Mutation 'R2471:Gm19402'
ID253102
Institutional Source Beutler Lab
Gene Symbol Gm19402
Ensembl Gene ENSMUSG00000095970
Gene Namepredicted gene, 19402
Synonyms
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2471 (G1)
Quality Score220
Status Not validated
Chromosome10
Chromosomal Location77689957-77690757 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 77690520 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092366] [ENSMUST00000180297]
Predicted Effect probably benign
Transcript: ENSMUST00000092366
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000180297
AA Change: S80T
SMART Domains Protein: ENSMUSP00000136066
Gene: ENSMUSG00000095970
AA Change: S80T

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 25 71 2.1e-6 PFAM
Pfam:Keratin_B2_2 67 112 8.1e-9 PFAM
Pfam:Keratin_B2_2 108 157 1.4e-5 PFAM
Pfam:Keratin_B2_2 152 193 3.1e-7 PFAM
Pfam:Keratin_B2_2 189 234 3.4e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Cstl1 T A 2: 148,751,121 Y65* probably null Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Gm19402
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Gm19402 APN 10 77690489 intron probably benign
R5743:Gm19402 UTSW 10 77690682 missense probably damaging 1.00
R6125:Gm19402 UTSW 10 77690673 missense probably damaging 0.99
R6285:Gm19402 UTSW 10 77690520 intron probably benign
R6361:Gm19402 UTSW 10 77690061 intron probably benign
R7372:Gm19402 UTSW 10 77690427 missense unknown
R8332:Gm19402 UTSW 10 77690214 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGCAGCAGAGGGTCATACAG -3'
(R):5'- GTGACCTAAGCTATGACAGGCG -3'

Sequencing Primer
(F):5'- CAGAGGGTCATACAGCAGGGC -3'
(R):5'- CTAAGCTATGACAGGCGGGTCTG -3'
Posted On2014-12-04