Incidental Mutation 'R2471:Cstl1'
ID253070
Institutional Source Beutler Lab
Gene Symbol Cstl1
Ensembl Gene ENSMUSG00000055177
Gene Namecystatin-like 1
Synonyms
MMRRC Submission 040403-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2471 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location148750358-148755433 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 148751121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 65 (Y65*)
Ref Sequence ENSEMBL: ENSMUSP00000105581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109952] [ENSMUST00000109954] [ENSMUST00000109955]
Predicted Effect probably null
Transcript: ENSMUST00000109952
AA Change: Y65*
SMART Domains Protein: ENSMUSP00000105578
Gene: ENSMUSG00000055177
AA Change: Y65*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CY 29 138 5.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109954
SMART Domains Protein: ENSMUSP00000105580
Gene: ENSMUSG00000055177

DomainStartEndE-ValueType
Pfam:Cystatin 13 74 5.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109955
AA Change: Y65*
SMART Domains Protein: ENSMUSP00000105581
Gene: ENSMUSG00000055177
AA Change: Y65*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CY 29 138 5.52e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located at the telomeric end of the cystatin locus and encodes a type 2 cystatin-like protein. The specific function of this protein has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,980,863 M390K probably benign Het
Bicra A G 7: 15,972,332 S1395P probably benign Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Csmd1 T A 8: 16,211,762 D907V probably damaging Het
Dnajc1 T C 2: 18,219,816 I213V possibly damaging Het
Emcn C T 3: 137,404,011 T138M probably damaging Het
F3 G T 3: 121,725,040 W51L probably damaging Het
Far2 A G 6: 148,138,694 Y41C probably damaging Het
Flrt1 A T 19: 7,096,491 D230E probably damaging Het
Gimap7 G A 6: 48,724,052 V191M probably damaging Het
Gm19402 A T 10: 77,690,520 probably benign Het
Ipo5 A C 14: 120,922,162 K134T probably benign Het
Kcnf1 T C 12: 17,175,530 E230G probably damaging Het
Mad1l1 T C 5: 140,261,552 E340G probably benign Het
Map4k5 T C 12: 69,856,846 I62V probably benign Het
March7 A G 2: 60,236,900 K588R possibly damaging Het
Mctp2 T A 7: 72,161,161 K52* probably null Het
Nr1h4 A T 10: 89,473,894 F310L probably damaging Het
Ofcc1 G A 13: 40,097,025 S605F probably damaging Het
Olfr1369-ps1 A T 13: 21,116,429 T246S probably damaging Het
Olfr1447 G A 19: 12,901,315 T155I probably benign Het
Olfr209 A T 16: 59,361,581 S212R possibly damaging Het
Pcdh20 T G 14: 88,467,236 E876A probably benign Het
Plce1 C T 19: 38,779,926 A2215V probably damaging Het
Ptprg T C 14: 12,210,327 Y128H probably damaging Het
Sigirr A G 7: 141,092,597 L204S probably damaging Het
Slc2a12 A T 10: 22,664,807 Y187F probably damaging Het
Slc31a2 A T 4: 62,296,075 R86W probably null Het
Smc1b T C 15: 85,092,017 K830E probably damaging Het
Ssrp1 A G 2: 85,042,298 N427D possibly damaging Het
Taar9 A T 10: 24,109,391 F48L probably benign Het
Taok2 T C 7: 126,875,100 E319G probably damaging Het
Try10 T C 6: 41,356,746 S142P probably damaging Het
Tsc22d1 A G 14: 76,418,204 T626A probably benign Het
Zfp101 T C 17: 33,380,976 E602G possibly damaging Het
Other mutations in Cstl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Cstl1 UTSW 2 148755325 missense probably damaging 1.00
R0477:Cstl1 UTSW 2 148750988 missense probably benign 0.06
R1706:Cstl1 UTSW 2 148751159 splice site probably null
R2938:Cstl1 UTSW 2 148751057 missense possibly damaging 0.59
R4005:Cstl1 UTSW 2 148755270 missense probably damaging 0.99
R5071:Cstl1 UTSW 2 148750927 start codon destroyed probably benign 0.01
R7019:Cstl1 UTSW 2 148755303 missense probably benign 0.03
R8126:Cstl1 UTSW 2 148754671 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTAAGTGCCTTCCGAAGC -3'
(R):5'- ACCAAATGAGCTGCTTAACTCAG -3'

Sequencing Primer
(F):5'- TAAGTGCCTTCCGAAGCCATGG -3'
(R):5'- TCAGAGATATCGTGTGCACC -3'
Posted On2014-12-04