Incidental Mutation 'R0315:Map2k5'
ID25408
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission 038525-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0315 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63303151 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 185 (H185Q)
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure
Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034920
AA Change: H185Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: H185Q

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213604
Meta Mutation Damage Score 0.6593 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,515,452 R409Q possibly damaging Het
Ank3 A T 10: 70,002,517 Q825L probably damaging Het
Ap1g1 A G 8: 109,819,035 I107V probably benign Het
Bub1b A T 2: 118,626,976 probably benign Het
Cd86 C T 16: 36,620,944 V54I possibly damaging Het
Dpys T G 15: 39,857,338 I9L probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 G T 3: 93,214,722 G1400C unknown Het
Gm28042 T C 2: 120,039,057 L634P probably damaging Het
Gm6712 G A 17: 17,316,118 noncoding transcript Het
Gpbp1 T G 13: 111,436,538 E360A possibly damaging Het
Hmgn1 A C 16: 96,124,817 I52R probably benign Het
Ing2 A C 8: 47,669,090 M141R probably benign Het
Klhl2 A T 8: 64,743,019 Y563* probably null Het
Lrrc9 A G 12: 72,456,028 T258A probably damaging Het
Map1b A T 13: 99,431,116 I1699N unknown Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Mroh1 C T 15: 76,427,600 A511V possibly damaging Het
Nop53 T C 7: 15,945,310 D90G probably damaging Het
Olfr1153 A T 2: 87,897,066 Y289F probably damaging Het
Olfr1447 A T 19: 12,901,234 V182D possibly damaging Het
Olfr370 T C 8: 83,541,372 V76A possibly damaging Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pkd2 T A 5: 104,459,850 S72T possibly damaging Het
Prc1 T C 7: 80,313,536 S587P probably damaging Het
Rdh7 G T 10: 127,888,396 T73K possibly damaging Het
Runx1 T C 16: 92,605,767 N429S probably damaging Het
Skint7 G A 4: 111,988,118 A376T possibly damaging Het
Slc16a14 T C 1: 84,912,496 I363V possibly damaging Het
Smarcal1 C T 1: 72,595,811 Q350* probably null Het
Soat1 T A 1: 156,440,513 K275* probably null Het
Speg T C 1: 75,415,136 V1571A possibly damaging Het
Stat5b G C 11: 100,788,460 D605E probably benign Het
Susd4 G A 1: 182,858,512 R209H probably benign Het
Tlr1 T G 5: 64,926,928 D102A probably damaging Het
Tm4sf5 A G 11: 70,510,636 N154D probably damaging Het
Tmigd3 T A 3: 105,916,769 M18K probably damaging Het
Ube2h A T 6: 30,241,413 V86E probably damaging Het
Utp20 A G 10: 88,807,421 L613P probably damaging Het
Vmn2r117 G A 17: 23,460,165 S695L probably benign Het
Washc5 T C 15: 59,341,976 D427G probably damaging Het
Zfp462 T A 4: 55,079,314 F2403I probably damaging Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0801:Map2k5 UTSW 9 63357979 splice site probably benign
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5059:Map2k5 UTSW 9 63257014 missense probably benign 0.41
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7228:Map2k5 UTSW 9 63358022 missense probably damaging 1.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8053:Map2k5 UTSW 9 63343425 missense probably benign 0.16
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCAAGAATCTTACAACACAGAGCTG -3'
(R):5'- CCTTCCTTTTGCTGCACATACACAAC -3'

Sequencing Primer
(F):5'- acacatctccaataccagcc -3'
(R):5'- atctgcctgcctctgcc -3'
Posted On2013-04-16