Incidental Mutation 'R8341:Map2k5'
ID644902
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8341 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63339098 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 116 (N116Y)
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034920
AA Change: N116Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: N116Y

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik A T X: 89,754,716 K718M probably damaging Het
Abca8b T A 11: 109,955,050 I915F probably damaging Het
Adam11 C A 11: 102,776,536 H641N probably damaging Het
Amfr A G 8: 93,999,178 S192P probably damaging Het
Ano9 T A 7: 141,102,334 N676I possibly damaging Het
Arfgef1 C T 1: 10,154,328 V1428I probably benign Het
B3gnt9 C T 8: 105,253,865 R297H probably benign Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
C1s1 C T 6: 124,531,156 A625T probably damaging Het
Camkmt T C 17: 85,439,580 L251P probably damaging Het
Ceacam15 C A 7: 16,672,003 V208F probably benign Het
Clp1 T C 2: 84,723,773 K351E probably damaging Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Cubn C A 2: 13,428,724 G1125V probably damaging Het
Dpp4 C T 2: 62,347,890 V633I probably benign Het
Eif2ak1 A T 5: 143,884,937 D357V probably benign Het
Fez1 T C 9: 36,876,309 M370T possibly damaging Het
Frk G A 10: 34,586,283 E257K probably damaging Het
Gm7579 T A 7: 142,212,119 C87* probably null Het
Henmt1 T C 3: 108,958,592 V211A probably damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ints9 T A 14: 65,036,414 V556E probably benign Het
Klhl41 T C 2: 69,670,524 S110P probably benign Het
Klrk1 T C 6: 129,622,700 probably benign Het
Kmt2e A T 5: 23,499,453 S1215C probably damaging Het
Lyn T C 4: 3,743,304 probably null Het
Map3k13 G T 16: 21,921,584 E554* probably null Het
Map6 A G 7: 99,268,440 E140G possibly damaging Het
Mpv17 A C 5: 31,154,103 probably null Het
Myo1c C T 11: 75,671,427 P883S probably benign Het
Myo7b T C 18: 31,983,926 M914V probably benign Het
Olfm2 C T 9: 20,672,622 probably null Het
Olfr124 G A 17: 37,805,652 C169Y probably damaging Het
Osbpl7 T G 11: 97,060,163 L612R probably damaging Het
Polq A T 16: 37,071,771 M2012L possibly damaging Het
Ppp1r7 G A 1: 93,346,278 D59N probably benign Het
Ptbp1 A C 10: 79,863,211 E534D probably benign Het
Qser1 A G 2: 104,789,475 Y241H probably damaging Het
Rbx1 T C 15: 81,473,877 L88P probably damaging Het
Rft1 T C 14: 30,689,881 L462P probably damaging Het
Serpinb9f T A 13: 33,327,307 L77* probably null Het
Shisa9 T C 16: 11,997,151 M221T possibly damaging Het
Slc12a2 T G 18: 57,879,209 F135V possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc44a2 T C 9: 21,342,199 F88L probably benign Het
Snx21 A G 2: 164,791,885 E197G probably damaging Het
Srarp T C 4: 141,433,396 D42G possibly damaging Het
Ssfa2 A T 2: 79,657,718 K715I probably damaging Het
St6galnac1 T A 11: 116,768,888 M200L probably benign Het
Stambpl1 A T 19: 34,234,001 Q154L probably benign Het
Szt2 G T 4: 118,392,836 R492S possibly damaging Het
Thbs3 G A 3: 89,225,391 R880Q probably benign Het
Tnks A T 8: 34,873,045 L473H probably damaging Het
Ttc4 A G 4: 106,665,696 S342P probably benign Het
Uckl1 T A 2: 181,569,719 M463L probably benign Het
Unc80 T C 1: 66,649,033 S2397P possibly damaging Het
Vmn2r73 T A 7: 85,857,920 H728L probably benign Het
Vsig10l T C 7: 43,463,954 V110A probably damaging Het
Zgrf1 T A 3: 127,560,915 L61* probably null Het
Zswim5 A G 4: 116,986,792 Y1009C probably damaging Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0315:Map2k5 UTSW 9 63303151 missense probably damaging 1.00
R0801:Map2k5 UTSW 9 63357979 splice site probably benign
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5059:Map2k5 UTSW 9 63257014 missense probably benign 0.41
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7228:Map2k5 UTSW 9 63358022 missense probably damaging 1.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8017:Map2k5 UTSW 9 63339121 missense probably damaging 0.98
R8053:Map2k5 UTSW 9 63343425 missense probably benign 0.16
R8247:Map2k5 UTSW 9 63371737 missense probably damaging 1.00
R8309:Map2k5 UTSW 9 63339079 critical splice donor site probably null
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAGGATCCACGTACATAC -3'
(R):5'- CAGTTCATAATTCCCACCTTGG -3'

Sequencing Primer
(F):5'- GTAAGCAAATACAGATGTGGCCCTTC -3'
(R):5'- GGTCTGGGGGCCACTTTTC -3'
Posted On2020-09-02