Incidental Mutation 'R2911:Cep104'
ID261240
Institutional Source Beutler Lab
Gene Symbol Cep104
Ensembl Gene ENSMUSG00000039523
Gene Namecentrosomal protein 104
Synonyms
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R2911 (G1)
Quality Score118
Status Not validated
Chromosome4
Chromosomal Location153975194-154008732 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 153995427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047497]
Predicted Effect probably null
Transcript: ENSMUST00000047497
SMART Domains Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523

DomainStartEndE-ValueType
coiled coil region 222 249 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
SCOP:d1gw5b_ 523 646 3e-5 SMART
coiled coil region 688 730 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183790
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Olfr958 T C 9: 39,550,821 I17V possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Cep104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Cep104 APN 4 153996959 missense possibly damaging 0.93
IGL02884:Cep104 APN 4 153989862 missense probably damaging 0.96
IGL02928:Cep104 APN 4 153981259 missense probably benign 0.18
IGL03119:Cep104 APN 4 153981724 missense probably damaging 1.00
R0409:Cep104 UTSW 4 153983053 splice site probably benign
R0505:Cep104 UTSW 4 153996304 missense probably benign 0.00
R0600:Cep104 UTSW 4 154006792 missense possibly damaging 0.58
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1221:Cep104 UTSW 4 153988445 missense probably benign 0.00
R1338:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1528:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1648:Cep104 UTSW 4 153979096 critical splice donor site probably null
R1831:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1832:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1911:Cep104 UTSW 4 154006798 missense possibly damaging 0.74
R1914:Cep104 UTSW 4 153989839 missense possibly damaging 0.79
R2516:Cep104 UTSW 4 153989146 missense probably damaging 1.00
R2910:Cep104 UTSW 4 153995427 splice site probably null
R3751:Cep104 UTSW 4 153981756 missense probably damaging 1.00
R3828:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3829:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3830:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R4474:Cep104 UTSW 4 153989236 missense possibly damaging 0.47
R4731:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4732:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4733:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R5306:Cep104 UTSW 4 154006242 missense probably benign 0.02
R5449:Cep104 UTSW 4 153985305 splice site probably null
R5567:Cep104 UTSW 4 154002277 missense possibly damaging 0.64
R5761:Cep104 UTSW 4 153981224 missense possibly damaging 0.63
R5980:Cep104 UTSW 4 153988473 missense probably benign 0.00
R7003:Cep104 UTSW 4 153993561 missense probably benign 0.00
R7179:Cep104 UTSW 4 153992867 missense probably damaging 0.99
R7376:Cep104 UTSW 4 153983052 splice site probably null
X0026:Cep104 UTSW 4 153986885 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCACGTGCTGCTCTCTACATAAATG -3'
(R):5'- ACCAGGGCTGCTAAAGTGAC -3'

Sequencing Primer
(F):5'- AGCAAACATGTCTAAATATATCTGCC -3'
(R):5'- GGCTGCTAAAGTGACACTTG -3'
Posted On2015-01-23