Mutagenetix > Incidental Mutation

Incidental Mutation 'R3830:Cep104'

273938

Institutional Source

Beutler Lab

Gene Symbol

Cep104

Ensembl Gene

ENSMUSG00000039523

Gene Name

centrosomal protein 104

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.480) question?

Stock #

R3830 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

153975194-154008732 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 153984943 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 207 (M207R)

Ref Sequence

ENSEMBL: ENSMUSP00000040762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047497]

AlphaFold

Q80V31

Predicted Effect

probably damaging
Transcript: ENSMUST00000047497
AA Change: M207R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523
AA Change: M207R

Domain	Start	End	E-Value	Type
coiled coil region	222	249	N/A	INTRINSIC
low complexity region	288	301	N/A	INTRINSIC
low complexity region	307	320	N/A	INTRINSIC
SCOP:d1gw5b_	523	646	3e-5	SMART
coiled coil region	688	730	N/A	INTRINSIC
low complexity region	889	903	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155414

Predicted Effect

probably benign
Transcript: ENSMUST00000183790

Meta Mutation Damage Score

0.4807

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.7%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agpat5	A	G	8: 18,879,605	E250G	probably benign	Het
Aox4	A	T	1: 58,255,511	T960S	probably damaging	Het
Bach2	T	A	4: 32,563,150	L539H	probably damaging	Het
Capn1	A	T	19: 5,994,847	L465Q	probably damaging	Het
Cd300c	A	G	11: 114,959,627	F117L	probably benign	Het
Chd2	A	G	7: 73,491,415	Y577H	possibly damaging	Het
Col4a1	C	A	8: 11,209,650	G1341V	probably damaging	Het
Cspg4	T	G	9: 56,897,621	D1905E	probably damaging	Het
Dhx37	T	C	5: 125,431,613	K86R	probably benign	Het
Drd2	T	A	9: 49,402,143	V204D	probably damaging	Het
Gclc	A	T	9: 77,791,960	I520L	probably benign	Het
Gpat3	A	G	5: 100,884,386	D183G	probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Gprin3	T	C	6: 59,353,633	E563G	probably benign	Het
Grm8	A	T	6: 27,761,229	L332*	probably null	Het
Grpel1	T	A	5: 36,469,483	N36K	probably benign	Het
Hecw1	C	T	13: 14,346,058	S198N	probably benign	Het
Kcna2	T	C	3: 107,104,796	I231T	probably benign	Het
Lpcat1	T	C	13: 73,489,093	I114T	possibly damaging	Het
Mast4	G	T	13: 102,738,811	H1350N	probably damaging	Het
Ncor2	T	C	5: 125,118,692		probably benign	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr222	G	T	11: 59,571,601	N46K	probably damaging	Het
Pigb	T	C	9: 73,017,473	N468S	probably benign	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Plekhg1	A	G	10: 3,873,400	T123A	probably damaging	Het
Ptges3l	T	C	11: 101,421,617	*67W	probably null	Het
Rgs12	G	A	5: 34,966,015	V381M	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Rsg1	C	T	4: 141,218,589	R148C	probably damaging	Het
Six2	G	T	17: 85,685,187	S296Y	probably damaging	Het
Slc5a12	T	A	2: 110,632,736	C392*	probably null	Het
Snx5	A	T	2: 144,254,901		probably null	Het
Svep1	A	G	4: 58,096,177	L1481P	probably damaging	Het
Tspan18	T	C	2: 93,220,108	I57V	probably benign	Het
Ube3b	C	A	5: 114,399,951	Q368K	probably damaging	Het
Zfhx4	A	T	3: 5,401,209	K2142N	probably damaging	Het
Zfp729a	A	T	13: 67,619,878	F744Y	probably damaging	Het

Other mutations in Cep104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02755:Cep104	APN	4	153996959	missense	possibly damaging	0.93
IGL02884:Cep104	APN	4	153989862	missense	probably damaging	0.96
IGL02928:Cep104	APN	4	153981259	missense	probably benign	0.18
IGL03119:Cep104	APN	4	153981724	missense	probably damaging	1.00
R0409:Cep104	UTSW	4	153983053	splice site	probably benign
R0505:Cep104	UTSW	4	153996304	missense	probably benign	0.00
R0600:Cep104	UTSW	4	154006792	missense	possibly damaging	0.58
R1208:Cep104	UTSW	4	153985379	missense	probably damaging	1.00
R1208:Cep104	UTSW	4	153985379	missense	probably damaging	1.00
R1221:Cep104	UTSW	4	153988445	missense	probably benign	0.00
R1338:Cep104	UTSW	4	153994508	missense	probably benign	0.01
R1528:Cep104	UTSW	4	153994508	missense	probably benign	0.01
R1648:Cep104	UTSW	4	153979096	critical splice donor site	probably null
R1831:Cep104	UTSW	4	154002546	missense	probably benign	0.30
R1832:Cep104	UTSW	4	154002546	missense	probably benign	0.30
R1911:Cep104	UTSW	4	154006798	missense	possibly damaging	0.74
R1914:Cep104	UTSW	4	153989839	missense	possibly damaging	0.79
R2516:Cep104	UTSW	4	153989146	missense	probably damaging	1.00
R2910:Cep104	UTSW	4	153995427	splice site	probably null
R2911:Cep104	UTSW	4	153995427	splice site	probably null
R3751:Cep104	UTSW	4	153981756	missense	probably damaging	1.00
R3828:Cep104	UTSW	4	153984943	missense	probably damaging	1.00
R3829:Cep104	UTSW	4	153984943	missense	probably damaging	1.00
R4474:Cep104	UTSW	4	153989236	missense	possibly damaging	0.47
R4731:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R4732:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R4733:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R5306:Cep104	UTSW	4	154006242	missense	probably benign	0.02
R5449:Cep104	UTSW	4	153985305	splice site	probably null
R5567:Cep104	UTSW	4	154002277	missense	possibly damaging	0.64
R5761:Cep104	UTSW	4	153981224	missense	possibly damaging	0.63
R5980:Cep104	UTSW	4	153988473	missense	probably benign	0.00
R7003:Cep104	UTSW	4	153993561	missense	probably benign	0.00
R7179:Cep104	UTSW	4	153992867	missense	probably damaging	0.99
R7376:Cep104	UTSW	4	153983052	splice site	probably null
R8278:Cep104	UTSW	4	153983665	missense	possibly damaging	0.92
R8877:Cep104	UTSW	4	153993528	missense	probably damaging	0.98
R9035:Cep104	UTSW	4	153979005	missense	probably benign	0.39
R9060:Cep104	UTSW	4	153989824	missense	probably damaging	0.98
R9165:Cep104	UTSW	4	153994514	critical splice donor site	probably null
X0026:Cep104	UTSW	4	153986885	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTGCTCACAACAGGTCACG -3'
(R):5'- CTCAGCCTTCAGGAACCTTC -3'

Sequencing Primer
(F):5'- TGAACGGCCTCTCTGAGTCAC -3'
(R):5'- CTTCAGGAACCTTCAGGGGTG -3'

Posted On

2015-04-02