Incidental Mutation 'R3830:Cep104'
ID273938
Institutional Source Beutler Lab
Gene Symbol Cep104
Ensembl Gene ENSMUSG00000039523
Gene Namecentrosomal protein 104
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location153975194-154008732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 153984943 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 207 (M207R)
Ref Sequence ENSEMBL: ENSMUSP00000040762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047497]
Predicted Effect probably damaging
Transcript: ENSMUST00000047497
AA Change: M207R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523
AA Change: M207R

DomainStartEndE-ValueType
coiled coil region 222 249 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
SCOP:d1gw5b_ 523 646 3e-5 SMART
coiled coil region 688 730 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155414
Predicted Effect probably benign
Transcript: ENSMUST00000183790
Meta Mutation Damage Score 0.4807 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat3 A G 5: 100,884,386 D183G probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Cep104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Cep104 APN 4 153996959 missense possibly damaging 0.93
IGL02884:Cep104 APN 4 153989862 missense probably damaging 0.96
IGL02928:Cep104 APN 4 153981259 missense probably benign 0.18
IGL03119:Cep104 APN 4 153981724 missense probably damaging 1.00
R0409:Cep104 UTSW 4 153983053 splice site probably benign
R0505:Cep104 UTSW 4 153996304 missense probably benign 0.00
R0600:Cep104 UTSW 4 154006792 missense possibly damaging 0.58
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1221:Cep104 UTSW 4 153988445 missense probably benign 0.00
R1338:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1528:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1648:Cep104 UTSW 4 153979096 critical splice donor site probably null
R1831:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1832:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1911:Cep104 UTSW 4 154006798 missense possibly damaging 0.74
R1914:Cep104 UTSW 4 153989839 missense possibly damaging 0.79
R2516:Cep104 UTSW 4 153989146 missense probably damaging 1.00
R2910:Cep104 UTSW 4 153995427 splice site probably null
R2911:Cep104 UTSW 4 153995427 splice site probably null
R3751:Cep104 UTSW 4 153981756 missense probably damaging 1.00
R3828:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3829:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R4474:Cep104 UTSW 4 153989236 missense possibly damaging 0.47
R4731:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4732:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4733:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R5306:Cep104 UTSW 4 154006242 missense probably benign 0.02
R5449:Cep104 UTSW 4 153985305 splice site probably null
R5567:Cep104 UTSW 4 154002277 missense possibly damaging 0.64
R5761:Cep104 UTSW 4 153981224 missense possibly damaging 0.63
R5980:Cep104 UTSW 4 153988473 missense probably benign 0.00
R7003:Cep104 UTSW 4 153993561 missense probably benign 0.00
R7179:Cep104 UTSW 4 153992867 missense probably damaging 0.99
R7376:Cep104 UTSW 4 153983052 splice site probably null
X0026:Cep104 UTSW 4 153986885 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCTCACAACAGGTCACG -3'
(R):5'- CTCAGCCTTCAGGAACCTTC -3'

Sequencing Primer
(F):5'- TGAACGGCCTCTCTGAGTCAC -3'
(R):5'- CTTCAGGAACCTTCAGGGGTG -3'
Posted On2015-04-02