Incidental Mutation 'R2911:Olfr958'
ID261252
Institutional Source Beutler Lab
Gene Symbol Olfr958
Ensembl Gene ENSMUSG00000050853
Gene Nameolfactory receptor 958
SynonymsMOR224-9, GA_x6K02T2PVTD-33247839-33246901
MMRRC Submission 040498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2911 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39547958-39554054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39550821 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 17 (I17V)
Ref Sequence ENSEMBL: ENSMUSP00000149788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062545] [ENSMUST00000215505] [ENSMUST00000217227]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062545
AA Change: I17V

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049930
Gene: ENSMUSG00000050853
AA Change: I17V

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 236 1.5e-6 PFAM
Pfam:7tm_1 41 288 3.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215505
AA Change: I17V

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217227
AA Change: I17V

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Adam10 C T 9: 70,718,723 S91L probably damaging Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Cacna1b A T 2: 24,607,541 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Clstn2 A G 9: 97,532,722 V373A probably damaging Het
Cyp2c65 T G 19: 39,087,682 I359M probably damaging Het
Cyp4a12b A T 4: 115,433,526 K282* probably null Het
Ddx1 C T 12: 13,231,440 probably null Het
Dnah7a A T 1: 53,427,824 probably null Het
Dzip1l T C 9: 99,655,602 V419A probably benign Het
Epha3 A C 16: 63,652,412 V370G probably benign Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Fryl T C 5: 73,050,456 D2457G probably damaging Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Lcp2 G A 11: 34,068,970 probably null Het
Lipo3 T A 19: 33,579,367 I220F probably benign Het
Lrp1b T C 2: 41,506,692 E340G probably benign Het
Mbtps1 A G 8: 119,546,037 I123T possibly damaging Het
Ndc80 A T 17: 71,500,376 S528R probably benign Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr873 A G 9: 20,300,479 K94R possibly damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Reep2 T C 18: 34,845,690 probably null Het
Rin3 T G 12: 102,373,584 S598A probably benign Het
Rreb1 A T 13: 37,948,920 E1690D probably benign Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Sox17 A T 1: 4,493,131 D92E probably damaging Het
Spata21 A G 4: 141,103,082 M288V possibly damaging Het
Sra1 T C 18: 36,676,185 D273G possibly damaging Het
Syt7 T C 19: 10,443,435 I448T probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tgs1 C A 4: 3,585,616 N164K probably benign Het
Tmem72 T A 6: 116,698,331 I67F possibly damaging Het
Ythdc1 T C 5: 86,816,559 S88P possibly damaging Het
Other mutations in Olfr958
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0446:Olfr958 UTSW 9 39550451 missense probably damaging 0.96
R0539:Olfr958 UTSW 9 39550297 missense probably damaging 0.99
R1512:Olfr958 UTSW 9 39550094 missense probably damaging 1.00
R1521:Olfr958 UTSW 9 39550784 missense possibly damaging 0.65
R1652:Olfr958 UTSW 9 39550295 missense probably benign 0.03
R2099:Olfr958 UTSW 9 39550667 missense probably benign 0.17
R2252:Olfr958 UTSW 9 39549977 missense probably damaging 0.99
R3722:Olfr958 UTSW 9 39550122 missense probably damaging 1.00
R5745:Olfr958 UTSW 9 39550691 missense probably damaging 1.00
R6460:Olfr958 UTSW 9 39550792 frame shift probably null
R6504:Olfr958 UTSW 9 39550278 missense probably damaging 1.00
R7063:Olfr958 UTSW 9 39550115 missense possibly damaging 0.87
R7162:Olfr958 UTSW 9 39550229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTGCTAAGTCCCATAAGG -3'
(R):5'- GCAATCTTTCTGTGGCATAGAGC -3'

Sequencing Primer
(F):5'- AGCATTTTTGGACAGGTCACAG -3'
(R):5'- GAGCCAAACACACTGCCAGTTG -3'
Posted On2015-01-23