Incidental Mutation 'R3147:Amy1'
ID 264274
Institutional Source Beutler Lab
Gene Symbol Amy1
Ensembl Gene ENSMUSG00000074264
Gene Name amylase 1, salivary
Synonyms Amy-1
MMRRC Submission 040599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R3147 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 113555710-113606699 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) T to C at 113570048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067980] [ENSMUST00000106540] [ENSMUST00000142505] [ENSMUST00000174147]
AlphaFold P00687
Predicted Effect probably benign
Transcript: ENSMUST00000067980
SMART Domains Protein: ENSMUSP00000070368
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106540
SMART Domains Protein: ENSMUSP00000102150
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Aamy 26 413 6.31e-97 SMART
Aamy_C 422 510 4.02e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142505
SMART Domains Protein: ENSMUSP00000120493
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Pfam:Alpha-amylase 36 271 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174147
SMART Domains Protein: ENSMUSP00000133875
Gene: ENSMUSG00000074264

DomainStartEndE-ValueType
Pfam:Alpha-amylase 35 129 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-amylase family of proteins. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, catalyzing the first step in digestion of dietary starch and glycogen. This gene and several family members are present in a gene cluster on chromosome 1. This gene encodes an amylase isoenzyme produced by the pancreas. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Atf2 T C 2: 73,850,939 probably null Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Ccdc158 T C 5: 92,657,963 N311S probably damaging Het
Dbx1 C A 7: 49,636,549 R56L probably damaging Het
Eif4enif1 T A 11: 3,244,003 probably null Het
Elmod3 T G 6: 72,586,502 T48P probably benign Het
Erbb2 T C 11: 98,434,039 S820P probably damaging Het
Fam214a A G 9: 75,008,838 I240V probably benign Het
Gimap8 T C 6: 48,650,506 V138A probably damaging Het
Hist1h1b T C 13: 21,780,115 probably benign Het
Il6ra G T 3: 89,885,928 P305Q probably benign Het
Kcng3 A G 17: 83,588,320 V239A possibly damaging Het
Kcnrg T C 14: 61,607,691 F60S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama1 A G 17: 67,737,658 D184G probably damaging Het
Lhcgr A T 17: 88,758,343 L206Q probably damaging Het
Lhx3 T C 2: 26,201,265 D344G probably benign Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Mtfr1 T C 3: 19,217,210 V182A probably benign Het
Olfr305 A G 7: 86,363,884 L151S probably benign Het
Olfr488 C T 7: 108,255,676 G154D possibly damaging Het
Rsf1 CG CGACGGAGGAG 7: 97,579,908 probably benign Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Soga1 T G 2: 157,020,364 K1548N possibly damaging Het
Sox7 A T 14: 63,948,634 Y373F probably damaging Het
Tuba1b T C 15: 98,932,505 T145A probably benign Het
Usp32 T A 11: 85,029,087 N718I probably damaging Het
Wapl G A 14: 34,725,149 V648M probably damaging Het
Zfp85 C T 13: 67,752,493 V10M probably damaging Het
Zgrf1 A G 3: 127,584,148 N1014S possibly damaging Het
Other mutations in Amy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Amy1 APN 3 113556132 missense probably damaging 1.00
IGL00966:Amy1 APN 3 113556040 missense probably benign 0.00
IGL01153:Amy1 APN 3 113556075 missense possibly damaging 0.69
IGL02415:Amy1 APN 3 113563585 missense probably benign 0.27
IGL02555:Amy1 APN 3 113564892 missense probably benign 0.01
IGL02572:Amy1 APN 3 113565073 splice site probably benign
IGL03215:Amy1 APN 3 113556000 missense probably benign
R0196:Amy1 UTSW 3 113569421 missense probably benign
R0230:Amy1 UTSW 3 113558430 missense probably benign 0.02
R0586:Amy1 UTSW 3 113562769 unclassified probably benign
R1789:Amy1 UTSW 3 113558165 missense possibly damaging 0.56
R1823:Amy1 UTSW 3 113562727 missense probably null
R1922:Amy1 UTSW 3 113564895 missense probably damaging 0.97
R2080:Amy1 UTSW 3 113558094 missense probably benign 0.01
R3437:Amy1 UTSW 3 113556009 missense probably damaging 1.00
R4961:Amy1 UTSW 3 113561849 missense probably damaging 1.00
R4977:Amy1 UTSW 3 113569377 splice site probably null
R5304:Amy1 UTSW 3 113558364 missense probably damaging 1.00
R5500:Amy1 UTSW 3 113562722 missense probably damaging 1.00
R5503:Amy1 UTSW 3 113556060 missense probably benign 0.26
R5706:Amy1 UTSW 3 113556120 missense probably damaging 0.99
R5866:Amy1 UTSW 3 113561920 missense possibly damaging 0.93
R5956:Amy1 UTSW 3 113563662 missense probably benign 0.04
R6110:Amy1 UTSW 3 113561900 missense probably damaging 1.00
R6259:Amy1 UTSW 3 113569410 missense possibly damaging 0.73
R6278:Amy1 UTSW 3 113561690 missense probably damaging 1.00
R6429:Amy1 UTSW 3 113569509 missense probably damaging 1.00
R6893:Amy1 UTSW 3 113563632 missense probably benign 0.00
R7136:Amy1 UTSW 3 113563599 missense probably damaging 1.00
R7463:Amy1 UTSW 3 113569884 nonsense probably null
R9193:Amy1 UTSW 3 113562629 missense probably benign 0.22
Z1177:Amy1 UTSW 3 113558353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCTAAGTATCTCTCACATTCC -3'
(R):5'- CACATACATGTATTTCTGGAAAGGGC -3'

Sequencing Primer
(F):5'- TTCCTTAGCAATATCAACCCAGCG -3'
(R):5'- TTCTGGAAAGGGCTAATATTTCTTC -3'
Posted On 2015-02-05