Incidental Mutation 'R3054:Armc6'
ID265078
Institutional Source Beutler Lab
Gene Symbol Armc6
Ensembl Gene ENSMUSG00000002343
Gene Namearmadillo repeat containing 6
Synonyms2410153K17Rik
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3054 (G1)
Quality Score207
Status Not validated
Chromosome8
Chromosomal Location70220172-70234466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70225149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 177 (V177L)
Ref Sequence ENSEMBL: ENSMUSP00000019679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019679] [ENSMUST00000130319]
Predicted Effect probably benign
Transcript: ENSMUST00000019679
AA Change: V177L

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000019679
Gene: ENSMUSG00000002343
AA Change: V177L

DomainStartEndE-ValueType
Blast:UTG 14 77 2e-26 BLAST
ARM 140 182 8.74e1 SMART
ARM 184 226 3.64e-7 SMART
ARM 237 280 6.01e0 SMART
ARM 281 323 1.13e-3 SMART
ARM 324 366 8.3e-2 SMART
ARM 368 410 1.06e1 SMART
Blast:ARM 438 468 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130319
SMART Domains Protein: ENSMUSP00000116811
Gene: ENSMUSG00000002343

DomainStartEndE-ValueType
Blast:UTG 14 78 8e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147387
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene's protein product has not been determined. A related protein in mouse suggests that this protein has a conserved function. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Armc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02251:Armc6 APN 8 70225220 nonsense probably null
IGL03090:Armc6 APN 8 70231354 missense probably benign 0.00
R1449:Armc6 UTSW 8 70225293 missense probably benign 0.01
R1557:Armc6 UTSW 8 70225448 missense possibly damaging 0.75
R1689:Armc6 UTSW 8 70229537 missense probably benign
R4368:Armc6 UTSW 8 70225293 missense probably benign 0.01
R6654:Armc6 UTSW 8 70231375 missense probably damaging 0.99
R7726:Armc6 UTSW 8 70222598 missense probably damaging 1.00
R8340:Armc6 UTSW 8 70220852 missense probably damaging 1.00
X0022:Armc6 UTSW 8 70222542 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CAAAGGGCACTCGGATATCATCATC -3'
(R):5'- TCTGTGACCAGTGCAAGCAG -3'

Sequencing Primer
(F):5'- GGCACTCGGATATCATCATCAAAGG -3'
(R):5'- GGAGCCTACCCAATCCTCCTG -3'
Posted On2015-02-05