Incidental Mutation 'R3055:Cxcr6'
ID265135
Institutional Source Beutler Lab
Gene Symbol Cxcr6
Ensembl Gene ENSMUSG00000048521
Gene Namechemokine (C-X-C motif) receptor 6
SynonymsSTRL33, BONZO
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3055 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123806475-123811760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123810464 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 177 (I177F)
Ref Sequence ENSEMBL: ENSMUSP00000060776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049810] [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000216072]
Predicted Effect probably damaging
Transcript: ENSMUST00000049810
AA Change: I177F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060776
Gene: ENSMUSG00000048521
AA Change: I177F

DomainStartEndE-ValueType
Pfam:7tm_1 57 297 5.2e-43 PFAM
low complexity region 324 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000216072
AA Change: I184F

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2774 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: A small percentage of mice that are heterozygous or homozygous for a knock-out allele develop medulloblastomas in the cerebellum after 12 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Cxcr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Cxcr6 APN 9 123810705 missense probably damaging 0.96
IGL03192:Cxcr6 APN 9 123810046 missense possibly damaging 0.52
IGL03342:Cxcr6 APN 9 123810407 nonsense probably null
PIT4362001:Cxcr6 UTSW 9 123810461 missense probably benign 0.00
R0399:Cxcr6 UTSW 9 123810951 missense possibly damaging 0.70
R0487:Cxcr6 UTSW 9 123810398 missense probably benign 0.02
R1496:Cxcr6 UTSW 9 123810347 missense probably benign 0.12
R1662:Cxcr6 UTSW 9 123810548 missense possibly damaging 0.71
R1733:Cxcr6 UTSW 9 123810116 missense probably damaging 1.00
R1869:Cxcr6 UTSW 9 123809957 missense probably benign 0.37
R3056:Cxcr6 UTSW 9 123810464 missense probably damaging 1.00
R3771:Cxcr6 UTSW 9 123810485 missense probably benign 0.02
R3828:Cxcr6 UTSW 9 123810869 missense probably benign
R4810:Cxcr6 UTSW 9 123810162 missense probably damaging 1.00
R5685:Cxcr6 UTSW 9 123810746 missense probably benign 0.01
R5748:Cxcr6 UTSW 9 123810341 missense probably damaging 1.00
R6210:Cxcr6 UTSW 9 123810008 missense possibly damaging 0.95
R6612:Cxcr6 UTSW 9 123810720 missense probably damaging 1.00
R6773:Cxcr6 UTSW 9 123810290 missense possibly damaging 0.83
R7414:Cxcr6 UTSW 9 123810222 nonsense probably null
R7427:Cxcr6 UTSW 9 123810240 missense probably benign 0.41
R7428:Cxcr6 UTSW 9 123810240 missense probably benign 0.41
R7863:Cxcr6 UTSW 9 123810849 missense probably damaging 0.98
R7946:Cxcr6 UTSW 9 123810849 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATGCAGGCACCTATGAGTG -3'
(R):5'- TGGAAGTTTCGAGCATGAAGC -3'

Sequencing Primer
(F):5'- TGTGCAAAACTCTTCGAGGC -3'
(R):5'- CAAGGTCTTGATAATGCCTGAGTAGC -3'
Posted On2015-02-05