Incidental Mutation 'R3056:Xrcc4'
ID 265186
Institutional Source Beutler Lab
Gene Symbol Xrcc4
Ensembl Gene ENSMUSG00000021615
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 4
Synonyms
MMRRC Submission 040565-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.508) question?
Stock # R3056 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 89774027-90089608 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90062077 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 83 (T83A)
Ref Sequence ENSEMBL: ENSMUSP00000124573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022115] [ENSMUST00000159199] [ENSMUST00000160232] [ENSMUST00000161396]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022115
AA Change: T83A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022115
Gene: ENSMUSG00000021615
AA Change: T83A

DomainStartEndE-ValueType
Pfam:XRCC4 1 326 1.5e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159199
AA Change: T83A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123934
Gene: ENSMUSG00000021615
AA Change: T83A

DomainStartEndE-ValueType
Pfam:XRCC4 1 310 2.7e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160232
AA Change: T83A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125486
Gene: ENSMUSG00000021615
AA Change: T83A

DomainStartEndE-ValueType
Pfam:XRCC4 1 94 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161396
AA Change: T83A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124573
Gene: ENSMUSG00000021615
AA Change: T83A

DomainStartEndE-ValueType
Pfam:XRCC4 1 83 5.4e-45 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternative splicing generates several transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have massive neuronal apoptosis, growth retardation, hypoplastic thymus and die by embryonic day 17.5. Lethality is rescued by Trp53 deficiency, but double knockout mice die from pro-B-cell lymphomas with Myc-Igh translocations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Other mutations in Xrcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Xrcc4 APN 13 90062050 missense probably benign 0.00
IGL01486:Xrcc4 APN 13 90062032 nonsense probably null
R0624:Xrcc4 UTSW 13 89992475 missense possibly damaging 0.81
R0629:Xrcc4 UTSW 13 90000905 splice site probably benign
R1801:Xrcc4 UTSW 13 89992579 missense probably damaging 1.00
R2567:Xrcc4 UTSW 13 90062142 missense probably damaging 0.99
R3055:Xrcc4 UTSW 13 90062077 missense probably benign 0.06
R3941:Xrcc4 UTSW 13 90071633 missense probably benign 0.01
R4486:Xrcc4 UTSW 13 89992588 missense possibly damaging 0.79
R4556:Xrcc4 UTSW 13 89992504 missense probably benign 0.02
R4599:Xrcc4 UTSW 13 90062007 critical splice donor site probably null
R6057:Xrcc4 UTSW 13 89991079 missense possibly damaging 0.95
R6262:Xrcc4 UTSW 13 89778787 missense probably benign 0.00
R6597:Xrcc4 UTSW 13 90000929 missense probably benign 0.24
R9080:Xrcc4 UTSW 13 90000978 missense probably damaging 0.99
R9535:Xrcc4 UTSW 13 89940999 missense probably benign 0.00
Z1176:Xrcc4 UTSW 13 89941042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGACCATCACACATGTG -3'
(R):5'- AACGGGGTGCTTAACTAAGG -3'

Sequencing Primer
(F):5'- TGTGATGCAGCACACATACACAG -3'
(R):5'- CCTTCAAATTTCTGTTACATTGGTAG -3'
Posted On 2015-02-05