Incidental Mutation 'R3080:Tro'
ID265407
Institutional Source Beutler Lab
Gene Symbol Tro
Ensembl Gene ENSMUSG00000025272
Gene Nametrophinin
SynonymsMaged3, Maged3l, magphinin, magphinin-alpha, magphinin-beta 2, magphinin-gamma, necdin and trophinin like, Tnn, Trol, trophinin-2
MMRRC Submission 040570-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3080 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location150645304-150657583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150655202 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 153 (T153I)
Ref Sequence ENSEMBL: ENSMUSP00000116905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087253] [ENSMUST00000087258] [ENSMUST00000112709] [ENSMUST00000148604] [ENSMUST00000151403] [ENSMUST00000163450] [ENSMUST00000163969] [ENSMUST00000164071]
Predicted Effect unknown
Transcript: ENSMUST00000087253
AA Change: T153I
SMART Domains Protein: ENSMUSP00000084508
Gene: ENSMUSG00000025272
AA Change: T153I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_2 62 105 5.33e-6 PROSPERO
internal_repeat_1 95 280 8.68e-15 PROSPERO
internal_repeat_2 120 164 5.33e-6 PROSPERO
internal_repeat_1 275 441 8.68e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 8e-60 PFAM
SCOP:d1gt91_ 780 951 9e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087258
AA Change: T153I
SMART Domains Protein: ENSMUSP00000084513
Gene: ENSMUSG00000025272
AA Change: T153I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 1.6e-58 PFAM
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112709
AA Change: T153I
SMART Domains Protein: ENSMUSP00000108329
Gene: ENSMUSG00000025272
AA Change: T153I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
MAGE 596 765 2.03e-90 SMART
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148604
AA Change: T153I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116905
Gene: ENSMUSG00000025272
AA Change: T153I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.1e-9 PROSPERO
internal_repeat_1 275 441 5.1e-9 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151403
AA Change: T153I
SMART Domains Protein: ENSMUSP00000120457
Gene: ENSMUSG00000025272
AA Change: T153I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 6.85e-11 PROSPERO
internal_repeat_1 275 441 6.85e-11 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 6.3e-60 PFAM
low complexity region 794 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163450
Predicted Effect unknown
Transcript: ENSMUST00000163969
AA Change: T153I
SMART Domains Protein: ENSMUSP00000126054
Gene: ENSMUSG00000025272
AA Change: T153I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.6e-10 PROSPERO
internal_repeat_1 275 441 5.6e-10 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 5.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164071
SMART Domains Protein: ENSMUSP00000126042
Gene: ENSMUSG00000025272

DomainStartEndE-ValueType
Pfam:MAGE 54 223 7.1e-61 PFAM
low complexity region 252 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171775
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that mediates cell adhesion between trophoblastic cells and the epithelial cells of the endometrium. The encoded protein participates in cell signalling during embryo implantation, and may also be involved in cancer formation. This gene is located near several other closely related genes on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
PHENOTYPE: Homozygous female or hemizygous male mice on a mixed 129 and NIH black Swiss background are viable, fertile and elderly mice exhibit no disorders. On an inbred 129 background, homozygous female or hemizygous male mice show partial embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer3 T G 1: 34,588,422 L581V probably benign Het
Anks4b A T 7: 120,181,923 D59V probably damaging Het
Cdc42bpb A G 12: 111,295,818 I75T probably damaging Het
Ces1c A C 8: 93,120,347 L93R probably damaging Het
Clca4a T A 3: 144,963,790 K333N probably damaging Het
Copa G T 1: 172,113,149 D710Y probably damaging Het
Cyp3a25 T A 5: 145,998,531 I92F probably benign Het
Dcx T A X: 143,923,270 D175V probably damaging Het
Fam76b G A 9: 13,833,162 G185D probably benign Het
Fam96b G C 8: 104,641,627 R22G possibly damaging Het
Fastkd5 T C 2: 130,615,453 M406V possibly damaging Het
Fbn2 G A 18: 58,149,050 S298L probably damaging Het
Gak T C 5: 108,613,602 K188E possibly damaging Het
Gemin2 G A 12: 59,025,091 C230Y probably damaging Het
Gm5150 A C 3: 15,990,921 S47A possibly damaging Het
Herc3 A T 6: 58,856,646 probably null Het
Hist1h3b A G 13: 23,752,498 H40R possibly damaging Het
Ighv5-6 T A 12: 113,625,617 D81V probably damaging Het
Igkv13-54-1 A G 6: 69,617,470 probably null Het
Itgad T C 7: 128,185,787 I288T possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Ltbp3 GTA GTATA 19: 5,756,888 probably null Het
Map4k2 G A 19: 6,353,188 E774K probably damaging Het
Mbtps1 A G 8: 119,531,205 V431A probably benign Het
Mbtps1 T C 8: 119,538,863 D315G probably damaging Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr115 T C 17: 37,610,278 T158A probably benign Het
Olfr214 T G 6: 116,557,217 V264G probably damaging Het
Pcdhb3 T G 18: 37,301,482 L167R probably damaging Het
Pcdhb8 A T 18: 37,356,166 E299V probably damaging Het
Shcbp1l A G 1: 153,436,037 E312G possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc1a2 T G 2: 102,748,556 L272R probably damaging Het
Slc35a5 A T 16: 45,144,395 S152T probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tbr1 C T 2: 61,807,291 Q65* probably null Het
Vmn1r222 A G 13: 23,232,461 M194T possibly damaging Het
Vmn2r1 A G 3: 64,089,784 D287G probably damaging Het
Vmn2r91 T G 17: 18,135,711 probably null Het
Zfp35 T A 18: 24,003,310 I237N probably damaging Het
Other mutations in Tro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Tro APN X 150655325 missense probably benign 0.45
IGL00818:Tro APN X 150648361 missense probably damaging 1.00
IGL03170:Tro APN X 150655560 missense probably benign 0.36
R0022:Tro UTSW X 150647512 intron probably benign
R0049:Tro UTSW X 150654569 missense possibly damaging 0.56
R1378:Tro UTSW X 150655571 missense probably damaging 1.00
R2228:Tro UTSW X 150655481 missense probably benign 0.17
R3437:Tro UTSW X 150646256 intron probably benign
R3715:Tro UTSW X 150654234 missense probably damaging 1.00
R3783:Tro UTSW X 150655052 missense possibly damaging 0.83
R3787:Tro UTSW X 150655052 missense possibly damaging 0.83
R3840:Tro UTSW X 150646202 intron probably benign
R4001:Tro UTSW X 150655202 missense probably benign 0.09
R5449:Tro UTSW X 150645970 intron probably benign
R7112:Tro UTSW X 150645856 intron probably benign
R7903:Tro UTSW X 150654520 intron probably benign
R7909:Tro UTSW X 150648624 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTTGGCCTTGGGTAGTAAC -3'
(R):5'- ACAAGCCTAAAGTAACTTTGCAGG -3'

Sequencing Primer
(F):5'- AACTGTGTGGGTAGCAGCC -3'
(R):5'- TGTTCACCCAGATCAGTCAGG -3'
Posted On2015-02-05