Incidental Mutation 'R2870:Esr1'
List |< first << previous [record 27 of 81] next >> last >|
ID266523
Institutional Source Beutler Lab
Gene Symbol Esr1
Ensembl Gene ENSMUSG00000019768
Gene Nameestrogen receptor 1 (alpha)
SynonymsERalpha, ERa, ER[a], Estra, Nr3a1, ESR, ER-alpha, Estr
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location4611593-5005614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4997890 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 481 (R481H)
Ref Sequence ENSEMBL: ENSMUSP00000101215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067086] [ENSMUST00000105589] [ENSMUST00000105590]
Predicted Effect probably damaging
Transcript: ENSMUST00000067086
AA Change: R481H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070070
Gene: ENSMUSG00000019768
AA Change: R481H

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105589
AA Change: R481H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101214
Gene: ENSMUSG00000019768
AA Change: R481H

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 2.3e-64 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105590
AA Change: R481H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101215
Gene: ENSMUSG00000019768
AA Change: R481H

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137012
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an estrogen receptor, a member of the nuclear hormone family of intracellular receptors. The encoded protein, activated by the sex hormone estrogen, is a transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Similar genes in human have been implicated in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for targeted null mutations have reduced skeletal growth and are infertile. Females exhibit hypoplastic uteri and nonovulatory ovaries, while males produce few sperm of low motility and fertilizing capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc163 T C 4: 116,741,861 silent Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm21759 T A 5: 8,180,863 probably benign Het
Gm5454 C A 13: 103,357,523 noncoding transcript Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Mapk7 C A 11: 61,490,212 probably benign Het
March8 C T 6: 116,401,145 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtm1 T C X: 71,296,362 probably benign Homo
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Otx1 A G 11: 21,998,681 probably benign Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pold1 C T 7: 44,543,347 silent Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Son A G 16: 91,664,317 probably null Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Esr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Esr1 APN 10 4997890 missense probably benign 0.00
IGL01886:Esr1 APN 10 4856861 missense probably damaging 0.98
IGL02174:Esr1 APN 10 4998003 missense probably damaging 1.00
IGL02625:Esr1 APN 10 5001346 missense probably benign 0.00
IGL02938:Esr1 APN 10 4783872 missense probably damaging 1.00
IGL03232:Esr1 APN 10 4969270 missense probably damaging 1.00
cybernetic UTSW 10 4783874 missense probably damaging 1.00
terminatrix UTSW 10 4746760 missense probably damaging 1.00
R0280:Esr1 UTSW 10 4856951 missense probably benign 0.05
R0280:Esr1 UTSW 10 4939289 missense probably damaging 0.99
R0479:Esr1 UTSW 10 4997911 missense probably damaging 1.00
R0943:Esr1 UTSW 10 4746781 missense probably damaging 1.00
R1437:Esr1 UTSW 10 4712571 small deletion probably benign
R1581:Esr1 UTSW 10 4997905 missense probably damaging 1.00
R1644:Esr1 UTSW 10 5001380 missense probably benign 0.00
R1647:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1648:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1791:Esr1 UTSW 10 4783913 missense probably damaging 1.00
R1955:Esr1 UTSW 10 4857125 missense probably damaging 1.00
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R4323:Esr1 UTSW 10 5001307 missense possibly damaging 0.48
R4727:Esr1 UTSW 10 5001418 missense probably benign 0.00
R5009:Esr1 UTSW 10 4712394 missense probably damaging 1.00
R5578:Esr1 UTSW 10 4969164 missense probably damaging 1.00
R5610:Esr1 UTSW 10 5001221 missense probably damaging 1.00
R5836:Esr1 UTSW 10 4712817 missense probably benign 0.02
R5938:Esr1 UTSW 10 4966245 intron probably benign
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6173:Esr1 UTSW 10 4746760 missense probably damaging 1.00
R6575:Esr1 UTSW 10 4966301 intron probably benign
R6888:Esr1 UTSW 10 4857076 missense probably benign 0.00
R7271:Esr1 UTSW 10 4783874 missense probably damaging 1.00
R7310:Esr1 UTSW 10 4939259 missense probably damaging 1.00
R7552:Esr1 UTSW 10 4856903 missense probably damaging 1.00
X0011:Esr1 UTSW 10 4712571 small deletion probably benign
X0018:Esr1 UTSW 10 5001325 missense probably benign
Z1088:Esr1 UTSW 10 4712667 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CTCAGTGATGTGGAGGTCTC -3'
(R):5'- AGTTACTTTGCCTACTCAGCGG -3'

Sequencing Primer
(F):5'- AGGTCTCAGAGAAAGCTCCCTG -3'
(R):5'- CCTGCTTTGGCTATCATACAGAG -3'
Posted On2015-02-18