Mutagenetix > Incidental Mutation

Incidental Mutation 'R2870:Grm5'

266514

Institutional Source

Beutler Lab

Gene Symbol

Grm5

Ensembl Gene

ENSMUSG00000049583

Gene Name

glutamate receptor, metabotropic 5

Synonyms

Glu5R, mGluR5, 6430542K11Rik, Gprc1e

MMRRC Submission

040458-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R2870 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87584168-88134907 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87602722 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 60 (V60A)

Ref Sequence

ENSEMBL: ENSMUSP00000114927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]

AlphaFold

Q3UVX5

Predicted Effect

probably benign
Transcript: ENSMUST00000107263
AA Change: V60A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: V60A

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.4e-97	PFAM
Pfam:Peripla_BP_6	130	332	2.5e-14	PFAM
Pfam:NCD3G	506	557	4.5e-20	PFAM
Pfam:7tm_3	588	824	7.4e-75	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125009
AA Change: V60A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: V60A

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.7e-101	PFAM
Pfam:Peripla_BP_6	129	327	5.4e-12	PFAM
Pfam:NCD3G	506	557	3.2e-16	PFAM
Pfam:7tm_3	590	823	3.5e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138732

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155358
AA Change: V60A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: V60A

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	4.1e-101	PFAM
Pfam:Peripla_BP_6	129	327	2.5e-12	PFAM
Pfam:NCD3G	506	557	9.4e-17	PFAM
Pfam:7tm_3	590	823	1.3e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	961	986	N/A	INTRINSIC
low complexity region	1000	1019	N/A	INTRINSIC
low complexity region	1078	1088	N/A	INTRINSIC
GluR_Homer-bdg	1153	1203	1.42e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167164
AA Change: V60A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129181
Gene: ENSMUSG00000049583
AA Change: V60A

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	4.1e-101	PFAM
Pfam:Peripla_BP_6	129	327	2.5e-12	PFAM
Pfam:NCD3G	506	557	9.4e-17	PFAM
Pfam:7tm_3	590	823	1.3e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	961	986	N/A	INTRINSIC
low complexity region	1000	1019	N/A	INTRINSIC
low complexity region	1078	1088	N/A	INTRINSIC
GluR_Homer-bdg	1153	1203	1.42e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208776

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208791

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	A	T	10: 22,067,379	I234N	probably benign	Het
Actrt3	A	G	3: 30,599,698	V51A	probably damaging	Het
Adgb	C	T	10: 10,431,281		probably null	Het
AI481877	A	C	4: 59,093,850	L226R	probably damaging	Het
Als2	A	G	1: 59,211,137	S483P	probably damaging	Het
Ankrd10	C	T	8: 11,615,682	R306H	probably damaging	Het
Arhgef10	T	C	8: 14,975,093		probably null	Het
Arhgef10	A	G	8: 14,975,666	I459V	probably benign	Het
Armc2	C	T	10: 41,966,700		probably null	Het
Atp12a	A	G	14: 56,386,950	R952G	possibly damaging	Het
Atp6v1g1	A	G	4: 63,550,021	Y87C	probably benign	Het
C030034I22Rik	T	A	17: 69,418,111		noncoding transcript	Het
Cacna2d1	G	A	5: 16,312,568	C404Y	probably damaging	Het
Ccdc163	T	C	4: 116,741,861		silent	Het
Ccdc59	A	T	10: 105,841,527	K9M	possibly damaging	Het
Cd6	A	G	19: 10,794,626	I307T	possibly damaging	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Csmd2	T	C	4: 128,557,718	F113S	unknown	Het
Csmd3	C	T	15: 47,857,924	G1437D	probably damaging	Het
Cyp4a14	C	A	4: 115,487,301	G456W	probably damaging	Het
Cyp4a30b	A	G	4: 115,458,362	H260R	possibly damaging	Het
Dcp1b	C	T	6: 119,214,774	S217L	probably benign	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Dmp1	A	G	5: 104,212,108	S217G	probably benign	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Eral1	A	G	11: 78,076,278	I164T	possibly damaging	Het
Esr1	G	A	10: 4,997,890	R481H	probably damaging	Het
Fam19a2	A	T	10: 123,704,365	H42L	possibly damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Gbp11	C	T	5: 105,331,000	D191N	probably benign	Het
Gm21759	T	A	5: 8,180,863		probably benign	Het
Gm5454	C	A	13: 103,357,523		noncoding transcript	Het
Gm9874	A	T	17: 30,485,789		probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Gria4	T	A	9: 4,503,614	N334I	probably damaging	Het
Ift172	C	T	5: 31,257,861	V1335I	probably benign	Het
Ino80d	C	T	1: 63,061,039		probably null	Het
Kif1c	A	G	11: 70,724,081	E567G	probably damaging	Het
Krt31	T	G	11: 100,047,873	N298T	possibly damaging	Het
Mapk7	C	A	11: 61,490,212		probably benign	Het
March8	C	T	6: 116,401,145		probably benign	Het
Matr3	T	A	18: 35,572,296	S91R	probably benign	Het
Mdm1	A	G	10: 118,150,942	T267A	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mtm1	T	C	X: 71,296,362		probably benign	Homo
Mtor	T	A	4: 148,540,030	M2089K	probably benign	Het
Mylk2	A	G	2: 152,919,348	K457R	probably damaging	Het
Nell1	A	T	7: 50,249,657		probably benign	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Odf3l2	G	A	10: 79,645,653	T14I	probably benign	Het
Olfr1080	T	C	2: 86,553,584	D180G	possibly damaging	Het
Olfr1510	T	G	14: 52,410,861	T4P	probably benign	Het
Olfr801	A	T	10: 129,669,759	C253*	probably null	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Otud4	T	A	8: 79,661,073	N300K	possibly damaging	Het
Otx1	A	G	11: 21,998,681		probably benign	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Pcdhb20	A	T	18: 37,505,780	Q453L	possibly damaging	Het
Pcdhga9	T	A	18: 37,737,471	Y118N	possibly damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Plcl1	A	T	1: 55,697,150	D550V	probably benign	Het
Plekhg5	T	A	4: 152,107,503	C433S	probably benign	Het
Plin2	A	G	4: 86,668,678	M1T	probably null	Het
Pold1	C	T	7: 44,543,347		silent	Het
Ppp1r7	T	A	1: 93,357,863		probably null	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Pzp	A	T	6: 128,485,556		probably null	Het
Rel	T	C	11: 23,761,129	I13V	probably benign	Het
Reln	C	T	5: 22,049,791	V527I	possibly damaging	Het
Retnla	A	G	16: 48,843,612	R90G	probably benign	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Slc5a8	A	G	10: 88,904,963	I247V	probably benign	Het
Son	A	G	16: 91,664,317		probably null	Het
Spcs2	T	C	7: 99,839,761	D240G	probably damaging	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
Stx3	A	T	19: 11,789,574	V91D	probably damaging	Het
Taf6l	A	G	19: 8,778,628		probably benign	Het
Tbc1d8	A	G	1: 39,405,317	F187S	probably damaging	Het
Thbs1	C	G	2: 118,119,378	N611K	probably damaging	Het
Tipin	A	C	9: 64,304,327	S232R	probably benign	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	C	T	8: 70,178,915		probably benign	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Ybx3	G	A	6: 131,370,413	A253V	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het
Zzz3	T	A	3: 152,446,844		silent	Het

Other mutations in Grm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Grm5	APN	7	88130781	missense	probably benign	0.00
IGL00970:Grm5	APN	7	87803896	missense	probably damaging	0.97
IGL01286:Grm5	APN	7	87602565	missense	probably benign	0.00
IGL01307:Grm5	APN	7	88075012	missense	probably damaging	1.00
IGL01603:Grm5	APN	7	87603178	missense	probably damaging	1.00
IGL01646:Grm5	APN	7	88040059	missense	probably damaging	1.00
IGL01705:Grm5	APN	7	88130046	missense	possibly damaging	0.59
IGL02184:Grm5	APN	7	88026442	missense	probably damaging	0.98
IGL02504:Grm5	APN	7	88130772	missense	probably benign
IGL02689:Grm5	APN	7	87602710	missense	probably damaging	1.00
IGL02725:Grm5	APN	7	88074665	missense	probably damaging	1.00
IGL02851:Grm5	APN	7	88074710	missense	probably damaging	0.98
IGL03106:Grm5	APN	7	88036070	missense	probably damaging	1.00
IGL03257:Grm5	APN	7	87602898	missense	possibly damaging	0.69
IGL03291:Grm5	APN	7	88130796	missense	probably damaging	1.00
BB004:Grm5	UTSW	7	88036174	missense	probably benign	0.16
BB014:Grm5	UTSW	7	88036174	missense	probably benign	0.16
R0078:Grm5	UTSW	7	88074977	missense	probably damaging	1.00
R0314:Grm5	UTSW	7	87602955	missense	probably damaging	0.97
R0318:Grm5	UTSW	7	87602967	missense	probably damaging	0.99
R0364:Grm5	UTSW	7	88074386	missense	probably damaging	1.00
R0380:Grm5	UTSW	7	88074376	missense	possibly damaging	0.92
R0454:Grm5	UTSW	7	88130789	missense	probably damaging	1.00
R0494:Grm5	UTSW	7	88130781	missense	probably benign	0.00
R0562:Grm5	UTSW	7	87603019	missense	probably damaging	1.00
R1695:Grm5	UTSW	7	88036103	missense	possibly damaging	0.47
R2012:Grm5	UTSW	7	88074872	missense	probably damaging	1.00
R2384:Grm5	UTSW	7	87602728	missense	probably damaging	1.00
R2510:Grm5	UTSW	7	88036091	missense	probably benign	0.21
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R3861:Grm5	UTSW	7	88129994	missense	possibly damaging	0.94
R4451:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R4626:Grm5	UTSW	7	88130153	missense	probably damaging	1.00
R4728:Grm5	UTSW	7	87975288	missense	probably damaging	1.00
R4914:Grm5	UTSW	7	88130129	missense	probably benign	0.00
R5122:Grm5	UTSW	7	88074820	missense	probably damaging	1.00
R5352:Grm5	UTSW	7	88074850	missense	probably damaging	1.00
R5361:Grm5	UTSW	7	88074496	missense	probably damaging	1.00
R5684:Grm5	UTSW	7	88130645	missense	probably benign
R5715:Grm5	UTSW	7	88130256	missense	probably benign	0.05
R5759:Grm5	UTSW	7	88026600	missense	probably damaging	0.96
R5844:Grm5	UTSW	7	87804024	missense	possibly damaging	0.88
R5889:Grm5	UTSW	7	87603073	missense	probably damaging	1.00
R6048:Grm5	UTSW	7	88026550	missense	probably damaging	1.00
R6145:Grm5	UTSW	7	88026601	missense	probably damaging	1.00
R6232:Grm5	UTSW	7	87602430	unclassified	probably benign
R6972:Grm5	UTSW	7	87602923	missense	probably benign	0.02
R7072:Grm5	UTSW	7	88074304	missense	probably damaging	1.00
R7258:Grm5	UTSW	7	88074706	missense	probably damaging	0.96
R7316:Grm5	UTSW	7	87975265	missense	probably benign
R7434:Grm5	UTSW	7	88130474	missense	probably benign	0.10
R7521:Grm5	UTSW	7	88074272	missense	possibly damaging	0.86
R7616:Grm5	UTSW	7	88116201	missense	probably benign
R7631:Grm5	UTSW	7	87975305	missense	probably damaging	1.00
R7655:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7656:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7739:Grm5	UTSW	7	88130058	missense	possibly damaging	0.46
R7897:Grm5	UTSW	7	88130861	missense	probably benign	0.14
R7927:Grm5	UTSW	7	88036174	missense	probably benign	0.16
R7967:Grm5	UTSW	7	87975361	missense	probably damaging	0.99
R8260:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R8345:Grm5	UTSW	7	88074538	missense	probably damaging	1.00
R8460:Grm5	UTSW	7	87603041	missense	probably damaging	1.00
R8473:Grm5	UTSW	7	87603070	missense	probably damaging	0.97
R8531:Grm5	UTSW	7	88130516	missense	probably benign	0.05
R8671:Grm5	UTSW	7	88116290	critical splice donor site	probably null
R8805:Grm5	UTSW	7	87803968	missense	probably damaging	1.00
R9036:Grm5	UTSW	7	88036189	missense	possibly damaging	0.94
R9106:Grm5	UTSW	7	88074539	missense	probably damaging	1.00
R9136:Grm5	UTSW	7	88040046	missense	possibly damaging	0.95
R9189:Grm5	UTSW	7	88074816	missense	probably damaging	1.00
R9196:Grm5	UTSW	7	88074310	missense	probably damaging	1.00
R9232:Grm5	UTSW	7	88074383	missense	probably damaging	1.00
R9234:Grm5	UTSW	7	88074232	missense	probably damaging	1.00
R9384:Grm5	UTSW	7	88074310	missense	probably damaging	1.00
R9424:Grm5	UTSW	7	88116276	missense	probably benign	0.00
R9531:Grm5	UTSW	7	88130867	makesense	probably null
R9631:Grm5	UTSW	7	87975352	missense	probably damaging	0.98
R9691:Grm5	UTSW	7	88074695	missense	probably damaging	1.00
Z1176:Grm5	UTSW	7	87602715	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAATCTGAGTTTCCTCCATCATG -3'
(R):5'- AGCGTACCAAGCCTTCTTCC -3'

Sequencing Primer
(F):5'- AAAATGGTCCTTCTGTTGATTCTGTC -3'
(R):5'- TCTTCCGAAGAGATGAGGGAATCC -3'

Posted On

2015-02-18