Incidental Mutation 'R2870:Gria4'
ID266521
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4503614 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 334 (N334I)
Ref Sequence ENSEMBL: ENSMUSP00000129316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027020
AA Change: N334I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: N334I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000063508
AA Change: N334I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: N334I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163309
AA Change: N334I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: N334I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3.2e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212533
AA Change: N334I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
C030034I22Rik T A 17: 69,418,111 noncoding transcript Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc163 T C 4: 116,741,861 silent Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gm21759 T A 5: 8,180,863 probably benign Het
Gm5454 C A 13: 103,357,523 noncoding transcript Het
Gm9874 A T 17: 30,485,789 probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Mapk7 C A 11: 61,490,212 probably benign Het
March8 C T 6: 116,401,145 probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mtm1 T C X: 71,296,362 probably benign Homo
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nell1 A T 7: 50,249,657 probably benign Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Otx1 A G 11: 21,998,681 probably benign Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Pold1 C T 7: 44,543,347 silent Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Son A G 16: 91,664,317 probably null Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Taf6l A G 19: 8,778,628 probably benign Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a C T 8: 70,178,915 probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Zzz3 T A 3: 152,446,844 silent Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7724:Gria4 UTSW 9 4472074 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGGAATACTGGACTCTTGATAACC -3'
(R):5'- CCACAGAGCTCCAAGATTTCTC -3'

Sequencing Primer
(F):5'- ATGCATATACAGAATAACCACTGC -3'
(R):5'- ACAGAGCTCCAAGATTTCTCTTTGTG -3'
Posted On2015-02-18