Mutagenetix > Incidental Mutation

Incidental Mutation 'R2870:Gria4'

266521

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

040458-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.770) question?

Stock #

R2870 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4503614 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 334 (N334I)

Ref Sequence

ENSEMBL: ENSMUSP00000129316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027020
AA Change: N334I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: N334I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063508
AA Change: N334I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: N334I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163309
AA Change: N334I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: N334I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212533
AA Change: N334I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	A	T	10: 22,067,379	I234N	probably benign	Het
Actrt3	A	G	3: 30,599,698	V51A	probably damaging	Het
Adgb	C	T	10: 10,431,281		probably null	Het
AI481877	A	C	4: 59,093,850	L226R	probably damaging	Het
Als2	A	G	1: 59,211,137	S483P	probably damaging	Het
Ankrd10	C	T	8: 11,615,682	R306H	probably damaging	Het
Arhgef10	T	C	8: 14,975,093		probably null	Het
Arhgef10	A	G	8: 14,975,666	I459V	probably benign	Het
Armc2	C	T	10: 41,966,700		probably null	Het
Atp12a	A	G	14: 56,386,950	R952G	possibly damaging	Het
Atp6v1g1	A	G	4: 63,550,021	Y87C	probably benign	Het
C030034I22Rik	T	A	17: 69,418,111		noncoding transcript	Het
Cacna2d1	G	A	5: 16,312,568	C404Y	probably damaging	Het
Ccdc163	T	C	4: 116,741,861		silent	Het
Ccdc59	A	T	10: 105,841,527	K9M	possibly damaging	Het
Cd6	A	G	19: 10,794,626	I307T	possibly damaging	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Csmd2	T	C	4: 128,557,718	F113S	unknown	Het
Csmd3	C	T	15: 47,857,924	G1437D	probably damaging	Het
Cyp4a14	C	A	4: 115,487,301	G456W	probably damaging	Het
Cyp4a30b	A	G	4: 115,458,362	H260R	possibly damaging	Het
Dcp1b	C	T	6: 119,214,774	S217L	probably benign	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Dmp1	A	G	5: 104,212,108	S217G	probably benign	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Eral1	A	G	11: 78,076,278	I164T	possibly damaging	Het
Esr1	G	A	10: 4,997,890	R481H	probably damaging	Het
Fam19a2	A	T	10: 123,704,365	H42L	possibly damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Gbp11	C	T	5: 105,331,000	D191N	probably benign	Het
Gm21759	T	A	5: 8,180,863		probably benign	Het
Gm5454	C	A	13: 103,357,523		noncoding transcript	Het
Gm9874	A	T	17: 30,485,789		probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Grm5	T	C	7: 87,602,722	V60A	possibly damaging	Het
Ift172	C	T	5: 31,257,861	V1335I	probably benign	Het
Ino80d	C	T	1: 63,061,039		probably null	Het
Kif1c	A	G	11: 70,724,081	E567G	probably damaging	Het
Krt31	T	G	11: 100,047,873	N298T	possibly damaging	Het
Mapk7	C	A	11: 61,490,212		probably benign	Het
March8	C	T	6: 116,401,145		probably benign	Het
Matr3	T	A	18: 35,572,296	S91R	probably benign	Het
Mdm1	A	G	10: 118,150,942	T267A	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mtm1	T	C	X: 71,296,362		probably benign	Homo
Mtor	T	A	4: 148,540,030	M2089K	probably benign	Het
Mylk2	A	G	2: 152,919,348	K457R	probably damaging	Het
Nell1	A	T	7: 50,249,657		probably benign	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Odf3l2	G	A	10: 79,645,653	T14I	probably benign	Het
Olfr1080	T	C	2: 86,553,584	D180G	possibly damaging	Het
Olfr1510	T	G	14: 52,410,861	T4P	probably benign	Het
Olfr801	A	T	10: 129,669,759	C253*	probably null	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Otud4	T	A	8: 79,661,073	N300K	possibly damaging	Het
Otx1	A	G	11: 21,998,681		probably benign	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Pcdhb20	A	T	18: 37,505,780	Q453L	possibly damaging	Het
Pcdhga9	T	A	18: 37,737,471	Y118N	possibly damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Plcl1	A	T	1: 55,697,150	D550V	probably benign	Het
Plekhg5	T	A	4: 152,107,503	C433S	probably benign	Het
Plin2	A	G	4: 86,668,678	M1T	probably null	Het
Pold1	C	T	7: 44,543,347		silent	Het
Ppp1r7	T	A	1: 93,357,863		probably null	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Pzp	A	T	6: 128,485,556		probably null	Het
Rel	T	C	11: 23,761,129	I13V	probably benign	Het
Reln	C	T	5: 22,049,791	V527I	possibly damaging	Het
Retnla	A	G	16: 48,843,612	R90G	probably benign	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Slc5a8	A	G	10: 88,904,963	I247V	probably benign	Het
Son	A	G	16: 91,664,317		probably null	Het
Spcs2	T	C	7: 99,839,761	D240G	probably damaging	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
Stx3	A	T	19: 11,789,574	V91D	probably damaging	Het
Taf6l	A	G	19: 8,778,628		probably benign	Het
Tbc1d8	A	G	1: 39,405,317	F187S	probably damaging	Het
Thbs1	C	G	2: 118,119,378	N611K	probably damaging	Het
Tipin	A	C	9: 64,304,327	S232R	probably benign	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	C	T	8: 70,178,915		probably benign	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Ybx3	G	A	6: 131,370,413	A253V	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het
Zzz3	T	A	3: 152,446,844		silent	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGGAATACTGGACTCTTGATAACC -3'
(R):5'- CCACAGAGCTCCAAGATTTCTC -3'

Sequencing Primer
(F):5'- ATGCATATACAGAATAACCACTGC -3'
(R):5'- ACAGAGCTCCAAGATTTCTCTTTGTG -3'

Posted On

2015-02-18