Incidental Mutation 'R0280:Esr1'
ID37469
Institutional Source Beutler Lab
Gene Symbol Esr1
Ensembl Gene ENSMUSG00000019768
Gene Nameestrogen receptor 1 (alpha)
SynonymsERalpha, ERa, ER[a], Estra, Nr3a1, ESR, ER-alpha, Estr
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R0280 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location4611593-5005614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4939289 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 396 (V396F)
Ref Sequence ENSEMBL: ENSMUSP00000101213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067086] [ENSMUST00000105588] [ENSMUST00000105589] [ENSMUST00000105590]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067086
AA Change: V396F

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070070
Gene: ENSMUSG00000019768
AA Change: V396F

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105588
AA Change: V396F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101213
Gene: ENSMUSG00000019768
AA Change: V396F

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 1.7e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 493 4.19e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105589
AA Change: V396F

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101214
Gene: ENSMUSG00000019768
AA Change: V396F

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 2.3e-64 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105590
AA Change: V396F

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101215
Gene: ENSMUSG00000019768
AA Change: V396F

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137012
Meta Mutation Damage Score 0.8275 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: This gene encodes an estrogen receptor, a member of the nuclear hormone family of intracellular receptors. The encoded protein, activated by the sex hormone estrogen, is a transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Similar genes in human have been implicated in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for targeted null mutations have reduced skeletal growth and are infertile. Females exhibit hypoplastic uteri and nonovulatory ovaries, while males produce few sperm of low motility and fertilizing capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Esr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Esr1 APN 10 4997890 missense probably benign 0.00
IGL01886:Esr1 APN 10 4856861 missense probably damaging 0.98
IGL02174:Esr1 APN 10 4998003 missense probably damaging 1.00
IGL02625:Esr1 APN 10 5001346 missense probably benign 0.00
IGL02938:Esr1 APN 10 4783872 missense probably damaging 1.00
IGL03232:Esr1 APN 10 4969270 missense probably damaging 1.00
cybernetic UTSW 10 4783874 missense probably damaging 1.00
terminatrix UTSW 10 4746760 missense probably damaging 1.00
R0280:Esr1 UTSW 10 4856951 missense probably benign 0.05
R0479:Esr1 UTSW 10 4997911 missense probably damaging 1.00
R0943:Esr1 UTSW 10 4746781 missense probably damaging 1.00
R1437:Esr1 UTSW 10 4712571 small deletion probably benign
R1581:Esr1 UTSW 10 4997905 missense probably damaging 1.00
R1644:Esr1 UTSW 10 5001380 missense probably benign 0.00
R1647:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1648:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1791:Esr1 UTSW 10 4783913 missense probably damaging 1.00
R1955:Esr1 UTSW 10 4857125 missense probably damaging 1.00
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R4323:Esr1 UTSW 10 5001307 missense possibly damaging 0.48
R4727:Esr1 UTSW 10 5001418 missense probably benign 0.00
R5009:Esr1 UTSW 10 4712394 missense probably damaging 1.00
R5578:Esr1 UTSW 10 4969164 missense probably damaging 1.00
R5610:Esr1 UTSW 10 5001221 missense probably damaging 1.00
R5836:Esr1 UTSW 10 4712817 missense probably benign 0.02
R5938:Esr1 UTSW 10 4966245 intron probably benign
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6173:Esr1 UTSW 10 4746760 missense probably damaging 1.00
R6575:Esr1 UTSW 10 4966301 intron probably benign
R6888:Esr1 UTSW 10 4857076 missense probably benign 0.00
R7271:Esr1 UTSW 10 4783874 missense probably damaging 1.00
R7310:Esr1 UTSW 10 4939259 missense probably damaging 1.00
R7552:Esr1 UTSW 10 4856903 missense probably damaging 1.00
X0011:Esr1 UTSW 10 4712571 small deletion probably benign
X0018:Esr1 UTSW 10 5001325 missense probably benign
Z1088:Esr1 UTSW 10 4712667 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCAAGCCATGTTCACATTGCCAG -3'
(R):5'- AGGCCACCGTGACTGATTGTAAAG -3'

Sequencing Primer
(F):5'- CACATTGCCAGTGATGATTACATTC -3'
(R):5'- AGCAGACAGCTTGCCTTAG -3'
Posted On2013-05-23