Incidental Mutation 'R3687:Eftud2'
ID 269576
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission 040683-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3687 (G1)
Quality Score 210
Status Validated
Chromosome 11
Chromosomal Location 102838473-102880985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102844201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 624 (E624G)
Ref Sequence ENSEMBL: ENSMUSP00000134327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably damaging
Transcript: ENSMUST00000021306
AA Change: E634G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929
AA Change: E634G

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107060
AA Change: E633G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929
AA Change: E633G

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131678
Predicted Effect probably benign
Transcript: ENSMUST00000132543
SMART Domains Protein: ENSMUSP00000133732
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFG_IV 1 65 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143323
Predicted Effect probably damaging
Transcript: ENSMUST00000172611
AA Change: E6G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134316
Gene: ENSMUSG00000020929
AA Change: E6G

DomainStartEndE-ValueType
low complexity region 85 98 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173679
AA Change: E624G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929
AA Change: E624G

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Meta Mutation Damage Score 0.9539 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,852,590 V115M probably damaging Het
Atp11c T C X: 60,281,644 Y431C probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
C2cd3 C T 7: 100,435,833 P1544L probably benign Het
Cd44 G A 2: 102,901,350 probably null Het
Col10a1 A G 10: 34,395,498 T489A probably benign Het
Dgkk T C X: 6,938,392 probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Elmo3 G A 8: 105,308,836 probably null Het
Galnt13 A T 2: 54,880,062 T289S probably benign Het
Gm16485 T C 9: 8,972,381 probably benign Het
Gm43302 A T 5: 105,280,266 V143D probably damaging Het
Gpr18 T C 14: 121,912,461 T51A probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Ighv1-24 T A 12: 114,773,080 I67F probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Myo3b A G 2: 70,245,314 E554G probably benign Het
Olfr1451 G A 19: 12,999,102 G39R probably damaging Het
Olfr819 A T 10: 129,966,712 probably null Het
Olfr888 A G 9: 38,108,881 Y60C probably damaging Het
Pclo A G 5: 14,668,995 T1049A unknown Het
Pkhd1l1 T C 15: 44,546,587 S2497P probably benign Het
Ppm1f T C 16: 16,923,883 V407A probably damaging Het
Ppox A G 1: 171,277,493 L374S probably damaging Het
Prkdc T C 16: 15,799,967 Y3221H probably benign Het
Ptprk A T 10: 28,473,043 I520F probably damaging Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3d A T 9: 21,914,908 M101K probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Tas2r114 T C 6: 131,689,268 T266A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trem3 T A 17: 48,257,927 V152D probably damaging Het
Vmn2r4 T A 3: 64,389,475 I630F possibly damaging Het
Vwa5b2 C A 16: 20,591,558 probably benign Het
Zfp518b A T 5: 38,674,112 H183Q probably damaging Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102865563 splice site probably benign
IGL01765:Eftud2 APN 11 102839256 missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102869127 missense probably benign 0.08
IGL02161:Eftud2 APN 11 102854876 splice site probably benign
IGL02165:Eftud2 APN 11 102851747 splice site probably benign
IGL02218:Eftud2 APN 11 102870213 missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102851754 splice site probably null
IGL02664:Eftud2 APN 11 102841712 missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102846614 missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102870256 splice site probably benign
IGL02870:Eftud2 APN 11 102862626 missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102870183 missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102868617 missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102864725 missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102864801 splice site probably benign
R0463:Eftud2 UTSW 11 102864771 missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102844222 missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102846620 missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102839253 missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102849184 missense probably benign
R1079:Eftud2 UTSW 11 102840044 nonsense probably null
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1208:Eftud2 UTSW 11 102864766 missense probably benign 0.22
R1220:Eftud2 UTSW 11 102851747 splice site probably benign
R1438:Eftud2 UTSW 11 102860042 missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102839440 missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102854771 splice site probably benign
R2270:Eftud2 UTSW 11 102864781 missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102844180 missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102844201 missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102841463 splice site probably null
R3892:Eftud2 UTSW 11 102846187 missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102860110 missense possibly damaging 0.51
R4091:Eftud2 UTSW 11 102839416 splice site probably null
R4794:Eftud2 UTSW 11 102870177 missense probably benign 0.14
R4841:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102854814 missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102867844 critical splice donor site probably null
R5208:Eftud2 UTSW 11 102841185 missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102840057 missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102864780 missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102838623 nonsense probably null
R7604:Eftud2 UTSW 11 102848012 missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102840108 missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8019:Eftud2 UTSW 11 102843348 critical splice donor site probably null
R8139:Eftud2 UTSW 11 102867859 missense probably benign 0.04
R8431:Eftud2 UTSW 11 102846236 missense probably benign 0.08
R8545:Eftud2 UTSW 11 102840271 missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102868621 missense probably damaging 1.00
R9089:Eftud2 UTSW 11 102869145 missense probably benign
R9173:Eftud2 UTSW 11 102843416 missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102860029 missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102839436 missense probably benign 0.03
R9604:Eftud2 UTSW 11 102846230 missense probably benign 0.11
R9664:Eftud2 UTSW 11 102868596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGAAAGCACTTTCTACAGAAGG -3'
(R):5'- AAGATTGAACCCAGGTCTCGG -3'

Sequencing Primer
(F):5'- GCACTTTCTACAGAAGGGTCTCTAG -3'
(R):5'- GTGTTTAAGCACTGAACCAGC -3'
Posted On 2015-02-19