Incidental Mutation 'R3744:Prpf8'
ID 271130
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Name pre-mRNA processing factor 8
Synonyms Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission 040730-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R3744 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 75377642-75400275 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 75397547 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000042972] [ENSMUST00000102510]
AlphaFold Q99PV0
Predicted Effect probably benign
Transcript: ENSMUST00000018449
AA Change: D2095E

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: D2095E

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000042972
SMART Domains Protein: ENSMUSP00000037238
Gene: ENSMUSG00000038195

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:Jnk-SapK_ap_N 27 195 2.1e-16 PFAM
Pfam:RILP 223 281 1.1e-21 PFAM
low complexity region 289 298 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102510
AA Change: D2095E

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: D2095E

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156923
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,330,190 (GRCm39) probably benign Het
Aox4 C T 1: 58,285,029 (GRCm39) H594Y probably damaging Het
Aspn G A 13: 49,720,036 (GRCm39) E351K probably damaging Het
BC004004 A G 17: 29,520,423 (GRCm39) *349W probably null Het
Elmo2 C T 2: 165,157,922 (GRCm39) D39N probably damaging Het
Fam161a T C 11: 22,970,410 (GRCm39) F196S probably damaging Het
Fam186a A G 15: 99,845,416 (GRCm39) V276A unknown Het
Fn3krp T C 11: 121,317,531 (GRCm39) probably null Het
Gnai3 T C 3: 108,016,714 (GRCm39) probably benign Het
Hspg2 C T 4: 137,292,815 (GRCm39) probably benign Het
Igkv5-43 G A 6: 69,752,921 (GRCm39) H54Y probably benign Het
Kif26b A G 1: 178,506,595 (GRCm39) I224V probably benign Het
Lyg1 T C 1: 37,988,923 (GRCm39) Y99C probably benign Het
Myh4 C T 11: 67,146,141 (GRCm39) R1400C probably damaging Het
Nf1 T C 11: 79,439,573 (GRCm39) S2262P probably benign Het
Pop5 T C 5: 115,378,567 (GRCm39) Y117H possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rapgef6 T C 11: 54,516,760 (GRCm39) F54S probably benign Het
Sptb T C 12: 76,647,174 (GRCm39) T1954A probably benign Het
Ssbp2 T C 13: 91,828,765 (GRCm39) probably benign Het
Tap1 A T 17: 34,412,586 (GRCm39) D541V probably damaging Het
Tcte1 A G 17: 45,850,597 (GRCm39) D291G probably damaging Het
Tpbg A G 9: 85,727,215 (GRCm39) R395G probably damaging Het
Trappc10 T A 10: 78,034,924 (GRCm39) S941C probably benign Het
Usp19 G A 9: 108,377,380 (GRCm39) R886Q probably damaging Het
Utp14b G T 1: 78,642,973 (GRCm39) E290D probably benign Het
Vmn1r30 A T 6: 58,412,804 (GRCm39) Y9* probably null Het
Vmn2r97 A G 17: 19,149,890 (GRCm39) H426R probably benign Het
Vwa3a A G 7: 120,351,817 (GRCm39) D27G probably benign Het
Zfp36 A G 7: 28,077,201 (GRCm39) S236P probably benign Het
Zfp616 C A 11: 73,974,813 (GRCm39) H452N probably benign Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75,386,472 (GRCm39) missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75,381,232 (GRCm39) missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75,386,570 (GRCm39) missense probably benign 0.32
IGL01946:Prpf8 APN 11 75,390,818 (GRCm39) missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75,392,660 (GRCm39) nonsense probably null
IGL02077:Prpf8 APN 11 75,386,635 (GRCm39) missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75,381,498 (GRCm39) missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75,400,084 (GRCm39) missense probably benign 0.32
cutter UTSW 11 75,386,252 (GRCm39) splice site probably null
BB009:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
BB019:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
PIT4514001:Prpf8 UTSW 11 75,387,181 (GRCm39) missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75,397,188 (GRCm39) missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75,396,075 (GRCm39) missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75,392,768 (GRCm39) splice site probably benign
R0573:Prpf8 UTSW 11 75,381,480 (GRCm39) missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75,394,270 (GRCm39) missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75,384,775 (GRCm39) missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75,385,256 (GRCm39) missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75,399,500 (GRCm39) unclassified probably benign
R1123:Prpf8 UTSW 11 75,386,111 (GRCm39) missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75,386,249 (GRCm39) critical splice donor site probably null
R1901:Prpf8 UTSW 11 75,395,570 (GRCm39) missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75,387,337 (GRCm39) missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75,378,547 (GRCm39) missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75,381,357 (GRCm39) missense probably benign
R2185:Prpf8 UTSW 11 75,377,939 (GRCm39) nonsense probably null
R2271:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75,386,860 (GRCm39) missense probably benign 0.00
R3893:Prpf8 UTSW 11 75,391,083 (GRCm39) missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75,381,528 (GRCm39) missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75,383,331 (GRCm39) missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75,400,054 (GRCm39) splice site probably null
R5186:Prpf8 UTSW 11 75,380,609 (GRCm39) missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75,391,030 (GRCm39) missense probably benign 0.02
R5288:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75,397,236 (GRCm39) missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75,399,784 (GRCm39) missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75,394,469 (GRCm39) missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75,394,464 (GRCm39) missense probably benign 0.20
R5620:Prpf8 UTSW 11 75,395,927 (GRCm39) missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75,395,564 (GRCm39) missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75,391,734 (GRCm39) missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75,400,015 (GRCm39) missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75,384,848 (GRCm39) critical splice donor site probably null
R6250:Prpf8 UTSW 11 75,384,334 (GRCm39) missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75,382,321 (GRCm39) missense probably benign 0.33
R6629:Prpf8 UTSW 11 75,386,252 (GRCm39) splice site probably null
R6804:Prpf8 UTSW 11 75,390,635 (GRCm39) missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75,381,562 (GRCm39) missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75,395,654 (GRCm39) missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75,386,984 (GRCm39) missense probably benign 0.02
R7089:Prpf8 UTSW 11 75,399,374 (GRCm39) missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75,381,226 (GRCm39) missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75,394,181 (GRCm39) nonsense probably null
R7182:Prpf8 UTSW 11 75,381,553 (GRCm39) missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75,384,783 (GRCm39) missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75,382,610 (GRCm39) missense probably benign 0.32
R7485:Prpf8 UTSW 11 75,399,738 (GRCm39) nonsense probably null
R7522:Prpf8 UTSW 11 75,400,102 (GRCm39) missense possibly damaging 0.82
R7546:Prpf8 UTSW 11 75,399,200 (GRCm39) missense probably damaging 1.00
R7596:Prpf8 UTSW 11 75,382,330 (GRCm39) missense probably benign 0.03
R7699:Prpf8 UTSW 11 75,391,022 (GRCm39) missense probably benign 0.02
R7731:Prpf8 UTSW 11 75,399,732 (GRCm39) missense probably damaging 0.97
R7821:Prpf8 UTSW 11 75,385,300 (GRCm39) missense probably benign 0.01
R7932:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
R8039:Prpf8 UTSW 11 75,393,368 (GRCm39) missense possibly damaging 0.95
R8067:Prpf8 UTSW 11 75,390,976 (GRCm39) missense probably damaging 0.98
R8316:Prpf8 UTSW 11 75,390,641 (GRCm39) missense possibly damaging 0.71
R8560:Prpf8 UTSW 11 75,382,600 (GRCm39) nonsense probably null
R8823:Prpf8 UTSW 11 75,384,282 (GRCm39) missense probably benign 0.05
R8977:Prpf8 UTSW 11 75,386,870 (GRCm39) missense probably benign 0.12
R9116:Prpf8 UTSW 11 75,380,589 (GRCm39) missense possibly damaging 0.71
R9166:Prpf8 UTSW 11 75,387,340 (GRCm39) missense possibly damaging 0.53
R9360:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R9453:Prpf8 UTSW 11 75,397,212 (GRCm39) missense possibly damaging 0.56
R9518:Prpf8 UTSW 11 75,394,486 (GRCm39) missense possibly damaging 0.72
R9532:Prpf8 UTSW 11 75,385,608 (GRCm39) missense probably benign 0.01
R9626:Prpf8 UTSW 11 75,385,681 (GRCm39) missense possibly damaging 0.53
R9760:Prpf8 UTSW 11 75,394,257 (GRCm39) missense probably benign 0.20
X0028:Prpf8 UTSW 11 75,397,590 (GRCm39) missense probably damaging 0.99
Z1177:Prpf8 UTSW 11 75,394,160 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTGACGAGATTATCACTTCAACC -3'
(R):5'- CCTCAAAGGTTCTGGAACTCTC -3'

Sequencing Primer
(F):5'- GACCTTCTCATCAAAGACTGAATGG -3'
(R):5'- CTCAAAGGTTCTGGAACTCTCAAGTG -3'
Posted On 2015-03-18