Incidental Mutation 'R5539:Prpf8'
ID 435833
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Name pre-mRNA processing factor 8
Synonyms Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission 043097-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R5539 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 75377642-75400275 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75394464 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1800 (T1800A)
Ref Sequence ENSEMBL: ENSMUSP00000099568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510]
AlphaFold Q99PV0
Predicted Effect probably benign
Transcript: ENSMUST00000018449
AA Change: T1800A

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: T1800A

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102510
AA Change: T1800A

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: T1800A

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,555,917 (GRCm39) S44C probably damaging Het
Abca4 A G 3: 121,963,557 (GRCm39) I846V probably damaging Het
Aldh4a1 T C 4: 139,365,833 (GRCm39) S275P probably benign Het
Arhgap12 A T 18: 6,111,932 (GRCm39) L144H probably benign Het
Ccdc141 A T 2: 76,845,437 (GRCm39) I1210N probably damaging Het
Ccdc175 T C 12: 72,191,587 (GRCm39) T330A probably benign Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dnah17 T C 11: 117,964,486 (GRCm39) K2444E probably benign Het
Dnajc3 G A 14: 119,208,159 (GRCm39) V265M probably damaging Het
Flg2 T A 3: 93,127,753 (GRCm39) Y2222N unknown Het
Flnc G T 6: 29,446,229 (GRCm39) G882V probably damaging Het
Fndc5 T A 4: 129,032,514 (GRCm39) V39D probably damaging Het
Gabrr3 A T 16: 59,281,758 (GRCm39) H371L probably benign Het
Gm10717 A T 9: 3,030,438 (GRCm39) H33L probably damaging Het
Gm5422 A G 10: 31,124,646 (GRCm39) noncoding transcript Het
Kri1 G A 9: 21,190,668 (GRCm39) Q280* probably null Het
Lcp1 T C 14: 75,466,738 (GRCm39) V615A probably benign Het
Ltbp4 T C 7: 27,027,149 (GRCm39) Y407C probably damaging Het
Med30 G T 15: 52,584,462 (GRCm39) D127Y probably damaging Het
Mybpc2 A G 7: 44,164,317 (GRCm39) V416A probably benign Het
Notch2 C T 3: 98,044,898 (GRCm39) R1607C probably damaging Het
Nr4a3 T A 4: 48,056,525 (GRCm39) probably null Het
Ntf5 G T 7: 45,065,354 (GRCm39) R162L probably benign Het
Nxpe3 A G 16: 55,711,034 (GRCm39) W2R possibly damaging Het
Or10d1c T C 9: 38,893,573 (GRCm39) I256V possibly damaging Het
Or14j4 T A 17: 37,921,646 (GRCm39) M1L probably benign Het
Or1m1 G A 9: 18,666,134 (GRCm39) R266C probably damaging Het
Or5p58 A T 7: 107,694,433 (GRCm39) C115S probably benign Het
Pan2 C A 10: 128,144,002 (GRCm39) D99E probably benign Het
Pcdh12 T C 18: 38,414,797 (GRCm39) H776R possibly damaging Het
Prdm2 T C 4: 142,859,264 (GRCm39) H1342R possibly damaging Het
Prss40 T C 1: 34,591,760 (GRCm39) *148W probably null Het
Pygo1 C T 9: 72,852,061 (GRCm39) P83S probably damaging Het
Raf1 G T 6: 115,596,317 (GRCm39) S619R probably damaging Het
Rtf1 A G 2: 119,560,405 (GRCm39) M596V possibly damaging Het
Slc12a5 T A 2: 164,829,126 (GRCm39) D578E possibly damaging Het
Slc35b4 A G 6: 34,153,737 (GRCm39) V18A probably damaging Het
Spata31 T A 13: 65,070,783 (GRCm39) I977K probably benign Het
Tor2a T C 2: 32,650,672 (GRCm39) I222T probably damaging Het
Trim23 T C 13: 104,334,541 (GRCm39) V347A probably damaging Het
Trip11 A G 12: 101,851,386 (GRCm39) S893P probably damaging Het
Trmt10c G A 16: 55,855,324 (GRCm39) P104S probably damaging Het
Ubr3 A T 2: 69,850,877 (GRCm39) Y1765F probably damaging Het
Zfp951 C T 5: 104,962,712 (GRCm39) E285K probably damaging Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75,386,472 (GRCm39) missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75,381,232 (GRCm39) missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75,386,570 (GRCm39) missense probably benign 0.32
IGL01946:Prpf8 APN 11 75,390,818 (GRCm39) missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75,392,660 (GRCm39) nonsense probably null
IGL02077:Prpf8 APN 11 75,386,635 (GRCm39) missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75,381,498 (GRCm39) missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75,400,084 (GRCm39) missense probably benign 0.32
cutter UTSW 11 75,386,252 (GRCm39) splice site probably null
BB009:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
BB019:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
PIT4514001:Prpf8 UTSW 11 75,387,181 (GRCm39) missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75,397,188 (GRCm39) missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75,396,075 (GRCm39) missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75,392,768 (GRCm39) splice site probably benign
R0573:Prpf8 UTSW 11 75,381,480 (GRCm39) missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75,394,270 (GRCm39) missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75,384,775 (GRCm39) missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75,385,256 (GRCm39) missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75,399,500 (GRCm39) unclassified probably benign
R1123:Prpf8 UTSW 11 75,386,111 (GRCm39) missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75,386,249 (GRCm39) critical splice donor site probably null
R1901:Prpf8 UTSW 11 75,395,570 (GRCm39) missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75,387,337 (GRCm39) missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75,378,547 (GRCm39) missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75,381,357 (GRCm39) missense probably benign
R2185:Prpf8 UTSW 11 75,377,939 (GRCm39) nonsense probably null
R2271:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75,386,860 (GRCm39) missense probably benign 0.00
R3744:Prpf8 UTSW 11 75,397,547 (GRCm39) splice site probably null
R3893:Prpf8 UTSW 11 75,391,083 (GRCm39) missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75,381,528 (GRCm39) missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75,383,331 (GRCm39) missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75,400,054 (GRCm39) splice site probably null
R5186:Prpf8 UTSW 11 75,380,609 (GRCm39) missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75,391,030 (GRCm39) missense probably benign 0.02
R5288:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75,397,236 (GRCm39) missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75,399,784 (GRCm39) missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75,394,469 (GRCm39) missense possibly damaging 0.89
R5620:Prpf8 UTSW 11 75,395,927 (GRCm39) missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75,395,564 (GRCm39) missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75,391,734 (GRCm39) missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75,400,015 (GRCm39) missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75,384,848 (GRCm39) critical splice donor site probably null
R6250:Prpf8 UTSW 11 75,384,334 (GRCm39) missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75,382,321 (GRCm39) missense probably benign 0.33
R6629:Prpf8 UTSW 11 75,386,252 (GRCm39) splice site probably null
R6804:Prpf8 UTSW 11 75,390,635 (GRCm39) missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75,381,562 (GRCm39) missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75,395,654 (GRCm39) missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75,386,984 (GRCm39) missense probably benign 0.02
R7089:Prpf8 UTSW 11 75,399,374 (GRCm39) missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75,381,226 (GRCm39) missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75,394,181 (GRCm39) nonsense probably null
R7182:Prpf8 UTSW 11 75,381,553 (GRCm39) missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75,384,783 (GRCm39) missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75,382,610 (GRCm39) missense probably benign 0.32
R7485:Prpf8 UTSW 11 75,399,738 (GRCm39) nonsense probably null
R7522:Prpf8 UTSW 11 75,400,102 (GRCm39) missense possibly damaging 0.82
R7546:Prpf8 UTSW 11 75,399,200 (GRCm39) missense probably damaging 1.00
R7596:Prpf8 UTSW 11 75,382,330 (GRCm39) missense probably benign 0.03
R7699:Prpf8 UTSW 11 75,391,022 (GRCm39) missense probably benign 0.02
R7731:Prpf8 UTSW 11 75,399,732 (GRCm39) missense probably damaging 0.97
R7821:Prpf8 UTSW 11 75,385,300 (GRCm39) missense probably benign 0.01
R7932:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
R8039:Prpf8 UTSW 11 75,393,368 (GRCm39) missense possibly damaging 0.95
R8067:Prpf8 UTSW 11 75,390,976 (GRCm39) missense probably damaging 0.98
R8316:Prpf8 UTSW 11 75,390,641 (GRCm39) missense possibly damaging 0.71
R8560:Prpf8 UTSW 11 75,382,600 (GRCm39) nonsense probably null
R8823:Prpf8 UTSW 11 75,384,282 (GRCm39) missense probably benign 0.05
R8977:Prpf8 UTSW 11 75,386,870 (GRCm39) missense probably benign 0.12
R9116:Prpf8 UTSW 11 75,380,589 (GRCm39) missense possibly damaging 0.71
R9166:Prpf8 UTSW 11 75,387,340 (GRCm39) missense possibly damaging 0.53
R9360:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R9453:Prpf8 UTSW 11 75,397,212 (GRCm39) missense possibly damaging 0.56
R9518:Prpf8 UTSW 11 75,394,486 (GRCm39) missense possibly damaging 0.72
R9532:Prpf8 UTSW 11 75,385,608 (GRCm39) missense probably benign 0.01
R9626:Prpf8 UTSW 11 75,385,681 (GRCm39) missense possibly damaging 0.53
R9760:Prpf8 UTSW 11 75,394,257 (GRCm39) missense probably benign 0.20
X0028:Prpf8 UTSW 11 75,397,590 (GRCm39) missense probably damaging 0.99
Z1177:Prpf8 UTSW 11 75,394,160 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGGTGAACTCTTCTCTAACCAG -3'
(R):5'- GAGGCTGGCTTCAAACTTGC -3'

Sequencing Primer
(F):5'- CAGATTATCTGGTTTGTGGATGACAC -3'
(R):5'- GCTGGCTTCAAACTTGCAAAGATC -3'
Posted On 2016-10-24