Incidental Mutation 'R6358:Prpf8'
ID513350
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Namepre-mRNA processing factor 8
SynonymsSfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location75486816-75509449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75491495 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 384 (V384A)
Ref Sequence ENSEMBL: ENSMUSP00000099568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]
Predicted Effect probably benign
Transcript: ENSMUST00000018449
AA Change: V384A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: V384A

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102510
AA Change: V384A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: V384A

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131283
AA Change: V329A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850
AA Change: V329A

DomainStartEndE-ValueType
Pfam:PRO8NT 58 92 1.9e-13 PFAM
Pfam:PRO8NT 90 154 2.5e-30 PFAM
low complexity region 314 333 N/A INTRINSIC
Pfam:PROCN 338 746 1.7e-226 PFAM
low complexity region 747 759 N/A INTRINSIC
Pfam:RRM_4 931 1024 5.3e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133995
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75494295 missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75495646 missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75490406 missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75495744 missense probably benign 0.32
IGL01946:Prpf8 APN 11 75499992 missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75501834 nonsense probably null
IGL02077:Prpf8 APN 11 75495809 missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75490672 missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75509258 missense probably benign 0.32
cutter UTSW 11 75495426 splice site probably null
PIT4514001:Prpf8 UTSW 11 75496355 missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75506362 missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75505249 missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75501942 splice site probably benign
R0573:Prpf8 UTSW 11 75490654 missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75503444 missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75493949 missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75494430 missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75508674 unclassified probably benign
R1123:Prpf8 UTSW 11 75495285 missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75490330 missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75495423 critical splice donor site probably null
R1901:Prpf8 UTSW 11 75504744 missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75496511 missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75487721 missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75490531 missense probably benign
R2185:Prpf8 UTSW 11 75487113 nonsense probably null
R2271:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75495363 missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75496034 missense probably benign 0.00
R3744:Prpf8 UTSW 11 75506721 unclassified probably null
R3893:Prpf8 UTSW 11 75500257 missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75490702 missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75491826 missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75492505 missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75509228 unclassified probably null
R5186:Prpf8 UTSW 11 75489783 missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75500204 missense probably benign 0.02
R5288:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75506410 missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75495799 missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75508958 missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75503643 missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75503638 missense probably benign 0.20
R5620:Prpf8 UTSW 11 75505101 missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75504738 missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75500908 missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75509189 missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75494022 critical splice donor site probably null
R6250:Prpf8 UTSW 11 75493508 missense possibly damaging 0.95
R6629:Prpf8 UTSW 11 75495426 splice site probably null
R6804:Prpf8 UTSW 11 75499809 missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75490736 missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75504828 missense possibly damaging 0.72
R7038:Prpf8 UTSW 11 75496158 missense probably benign 0.02
R7089:Prpf8 UTSW 11 75508548 missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75490400 missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75503355 nonsense probably null
R7182:Prpf8 UTSW 11 75490727 missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75493957 missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75491784 missense probably benign 0.32
R7485:Prpf8 UTSW 11 75508912 nonsense probably null
R7522:Prpf8 UTSW 11 75509276 missense possibly damaging 0.82
R7546:Prpf8 UTSW 11 75508374 missense probably damaging 1.00
R7596:Prpf8 UTSW 11 75491504 missense probably benign 0.03
R7731:Prpf8 UTSW 11 75508906 missense probably damaging 0.97
R7821:Prpf8 UTSW 11 75494474 missense probably benign 0.01
R8039:Prpf8 UTSW 11 75502542 missense possibly damaging 0.95
R8067:Prpf8 UTSW 11 75500150 missense probably damaging 0.98
X0028:Prpf8 UTSW 11 75506764 missense probably damaging 0.99
Z1177:Prpf8 UTSW 11 75503334 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AAGCCGGTGGGTTGATTTCC -3'
(R):5'- AGACAGTCTTTTCTCGCATGC -3'

Sequencing Primer
(F):5'- GGGTTGATTTCCTGCTTAGCTCTC -3'
(R):5'- ATGCTGCTCTACTACCCCTTAGG -3'
Posted On2018-04-27