Mutagenetix > Incidental Mutation

Incidental Mutation 'R8977:Prpf8'

683518

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R8977 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75486816-75509449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75496044 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1105 (E1105G)

Ref Sequence

ENSEMBL: ENSMUSP00000018449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

probably benign
Transcript: ENSMUST00000018449
AA Change: E1105G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: E1105G

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102510
AA Change: E1105G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: E1105G

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131283

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,328,408	I984N	probably damaging	Het
4930438A08Rik	A	G	11: 58,293,884	E476G	unknown	Het
Aars	G	A	8: 111,040,217	R77Q	probably damaging	Het
Abcc10	C	A	17: 46,313,667	V795L	probably benign	Het
Adam30	A	G	3: 98,162,062	K276E	probably damaging	Het
Adam6b	A	T	12: 113,490,376	N271I	probably benign	Het
Adgrl2	T	C	3: 148,954,587	I17V	probably null	Het
Anapc1	C	A	2: 128,641,402	G1258C	probably damaging	Het
Ank2	G	T	3: 126,944,926	H2436Q	unknown	Het
Ankrd13a	A	T	5: 114,795,745	K267*	probably null	Het
Apob	T	C	12: 8,015,990	Y4320H	probably damaging	Het
Atp2b2	T	C	6: 113,773,364	D678G	probably damaging	Het
Bhlhe41	C	A	6: 145,863,370	V239F	possibly damaging	Het
Cbfa2t2	T	G	2: 154,500,490	L42R	probably benign	Het
Ccdc173	T	C	2: 69,787,299	H46R	possibly damaging	Het
Ccer2	G	A	7: 28,756,688	V52M	probably damaging	Het
Ccnj	T	C	19: 40,844,939	F187S	probably damaging	Het
Cd109	G	A	9: 78,707,528	V1286I	probably benign	Het
Cfap46	G	T	7: 139,679,933	T148N	probably benign	Het
Chmp7	A	G	14: 69,721,235	V210A	probably benign	Het
Cuzd1	A	G	7: 131,322,025	F8S	probably benign	Het
Dnmbp	A	T	19: 43,852,312	D549E	probably damaging	Het
Dpp4	A	G	2: 62,374,403	L240P	probably benign	Het
Dst	A	T	1: 34,247,783	R3398S	probably damaging	Het
Eml6	A	G	11: 29,784,182	I1186T	possibly damaging	Het
Extl1	T	C	4: 134,359,124	E540G	possibly damaging	Het
Gdpd5	A	G	7: 99,453,850	I339V	probably benign	Het
Ggcx	T	C	6: 72,429,282		probably null	Het
Gm9195	A	G	14: 72,453,898	F1637L	unknown	Het
Igkv5-48	G	C	6: 69,726,632	N96K	possibly damaging	Het
Itga11	T	C	9: 62,755,640	I546T	probably damaging	Het
Map3k5	T	A	10: 20,079,254	F624L	possibly damaging	Het
Map7	T	A	10: 20,269,590		probably null	Het
Mdga2	A	T	12: 66,797,635	D196E	possibly damaging	Het
Mettl2	T	C	11: 105,128,965	C143R	probably benign	Het
Mut	G	T	17: 40,938,590	R152L	probably benign	Het
Ncam1	G	T	9: 49,507,525	T825K	probably damaging	Het
Nucb2	C	A	7: 116,528,828	N257K	probably benign	Het
Olfr1085	C	T	2: 86,658,128	C110Y	probably benign	Het
Olfr1535	T	A	13: 21,555,846	M59L	possibly damaging	Het
Olfr378	A	G	11: 73,425,825	S53P	probably benign	Het
Olfr406	A	T	11: 74,269,478	I30F	probably benign	Het
Olfr640	A	T	7: 104,021,555	Y254*	probably null	Het
Olfr664	A	T	7: 104,734,041	F108I	probably damaging	Het
Pamr1	T	A	2: 102,611,618	V184D	probably damaging	Het
Paqr9	A	T	9: 95,560,835	I293F	possibly damaging	Het
Pi15	G	T	1: 17,619,902		probably null	Het
Pkm	T	A	9: 59,671,640	I301N	probably damaging	Het
Pramel1	T	A	4: 143,397,391	I212N	probably benign	Het
Prdm6	A	T	18: 53,568,301	I549F	probably damaging	Het
Rad51b	T	A	12: 79,657,888	V274E	probably damaging	Het
Rd3l	T	A	12: 111,980,159	Y61F	probably damaging	Het
Rgs11	T	C	17: 26,208,259	V388A	probably damaging	Het
Rictor	A	G	15: 6,783,085	I901V	probably benign	Het
Riox2	A	G	16: 59,491,832	D444G	probably benign	Het
Scn2a	T	A	2: 65,763,670	V1621E	probably damaging	Het
Sec11c	A	G	18: 65,812,747	I94V	possibly damaging	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slc34a1	T	C	13: 55,409,002	I337T	probably benign	Het
Slc6a19	T	C	13: 73,682,150	K516E	probably benign	Het
Slco1b2	A	T	6: 141,683,254	M596L	probably benign	Het
Smarce1	A	G	11: 99,219,685	I100T	possibly damaging	Het
Stk32c	A	T	7: 139,125,245	M119K	possibly damaging	Het
Tekt2	T	C	4: 126,323,473		probably null	Het
Tenm4	A	T	7: 96,811,970	N908Y	probably damaging	Het
Tex38	A	G	4: 115,780,595	S4P	probably benign	Het
Top2b	T	A	14: 16,393,239	H299Q	probably benign	Het
Trim55	C	A	3: 19,659,177	R131S	probably benign	Het
Vmn2r109	A	T	17: 20,554,269	Y275N	possibly damaging	Het
Vmn2r116	C	T	17: 23,386,942	T276I	possibly damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75495646	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75490406	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75495744	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75499992	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75501834	nonsense	probably null
IGL02077:Prpf8	APN	11	75495809	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75490672	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75509258	missense	probably benign	0.32
cutter	UTSW	11	75495426	splice site	probably null
BB009:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75496355	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75506362	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75505249	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75501942	splice site	probably benign
R0573:Prpf8	UTSW	11	75490654	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75503444	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75493949	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75494430	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75508674	unclassified	probably benign
R1123:Prpf8	UTSW	11	75495285	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75495423	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75504744	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75496511	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75487721	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75490531	missense	probably benign
R2185:Prpf8	UTSW	11	75487113	nonsense	probably null
R2271:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75496034	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75506721	splice site	probably null
R3893:Prpf8	UTSW	11	75500257	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75490702	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75492505	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75509228	splice site	probably null
R5186:Prpf8	UTSW	11	75489783	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75500204	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75506410	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75508958	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75503643	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75503638	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75505101	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75504738	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75500908	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75509189	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75494022	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75493508	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75491495	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75495426	splice site	probably null
R6804:Prpf8	UTSW	11	75499809	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75490736	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75504828	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75496158	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75508548	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75490400	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75503355	nonsense	probably null
R7182:Prpf8	UTSW	11	75490727	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75493957	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75491784	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75508912	nonsense	probably null
R7522:Prpf8	UTSW	11	75509276	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75508374	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75491504	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75500196	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75508906	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75494474	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75502542	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75500150	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75499815	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75491774	nonsense	probably null
R8823:Prpf8	UTSW	11	75493456	missense	probably benign	0.05
R9116:Prpf8	UTSW	11	75489763	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75496514	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75506386	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75503660	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75494782	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75494855	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75503431	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75506764	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75503334	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TCAGGTAATGACACACAGCTC -3'
(R):5'- GGACTAACATCCTCGTGATTCC -3'

Sequencing Primer
(F):5'- AGCCATGCTCTGTCTGTGCAG -3'
(R):5'- GTGATTCCACAAACCCAGCTGAG -3'

Posted On

2021-10-11