Mutagenetix > Incidental Mutation

Incidental Mutation 'R0967:Prpf8'

83916

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

039096-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R0967 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75377642-75400275 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75385256 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 797 (V797E)

Ref Sequence

ENSEMBL: ENSMUSP00000115635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018449
AA Change: V852E

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: V852E

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102510
AA Change: V852E

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: V852E

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131283
AA Change: V797E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850
AA Change: V797E

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133995

Meta Mutation Damage Score

0.3041

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.1%
20x: 90.5%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	G	T	18: 59,105,812 (GRCm39)	E736*	probably null	Het
Atxn7l3	C	G	11: 102,183,261 (GRCm39)		probably benign	Het
Camk1g	T	C	1: 193,032,604 (GRCm39)	E269G	probably damaging	Het
Ccrl2	G	A	9: 110,884,754 (GRCm39)	T248M	probably benign	Het
Chd9	T	C	8: 91,716,107 (GRCm39)	S421P	probably damaging	Het
Cndp1	G	A	18: 84,652,777 (GRCm39)		probably benign	Het
Cplane2	T	C	4: 140,947,162 (GRCm39)	M181T	probably benign	Het
Csmd3	T	C	15: 47,721,227 (GRCm39)	E1468G	probably null	Het
Cyc1	T	C	15: 76,229,848 (GRCm39)		probably benign	Het
Fli1	T	A	9: 32,372,745 (GRCm39)	T98S	probably benign	Het
Gk2	T	C	5: 97,604,155 (GRCm39)	S228G	probably benign	Het
Gse1	T	A	8: 121,297,594 (GRCm39)		probably benign	Het
Hgf	T	A	5: 16,798,839 (GRCm39)		probably benign	Het
Hif1a	G	A	12: 73,984,444 (GRCm39)	V300I	possibly damaging	Het
Hsd17b4	C	A	18: 50,316,328 (GRCm39)	H652N	probably benign	Het
Hsh2d	G	A	8: 72,954,304 (GRCm39)	D229N	probably benign	Het
Kif5c	T	A	2: 49,588,128 (GRCm39)		probably benign	Het
Lgr6	T	C	1: 134,921,750 (GRCm39)	Y198C	probably damaging	Het
Lpcat2b	T	A	5: 107,582,084 (GRCm39)	M471K	possibly damaging	Het
Med21	A	G	6: 146,551,697 (GRCm39)	E116G	probably benign	Het
Mos	A	G	4: 3,870,932 (GRCm39)	S295P	probably benign	Het
Ms4a15	A	T	19: 10,956,685 (GRCm39)	V209E	probably damaging	Het
Mttp	A	G	3: 137,798,484 (GRCm39)	V804A	probably benign	Het
Or10ah1-ps1	A	G	5: 143,123,594 (GRCm39)	M121T	probably damaging	Het
Or52n4b	T	C	7: 108,143,996 (GRCm39)	I86T	probably damaging	Het
Or5ac23	T	A	16: 59,149,546 (GRCm39)	T109S	possibly damaging	Het
Plagl1	T	C	10: 13,003,986 (GRCm39)		probably benign	Het
Rars2	A	G	4: 34,646,587 (GRCm39)	D284G	probably benign	Het
Rassf8	T	C	6: 145,765,676 (GRCm39)		probably benign	Het
Rfx3	A	G	19: 27,783,751 (GRCm39)		probably benign	Het
Ripk4	A	T	16: 97,545,372 (GRCm39)	M362K	probably damaging	Het
Rubcn	C	A	16: 32,646,087 (GRCm39)	E815D	probably benign	Het
Scn8a	A	G	15: 100,933,527 (GRCm39)	Y1577C	probably damaging	Het
Sec24b	C	T	3: 129,790,431 (GRCm39)	R698Q	probably damaging	Het
Ssc5d	T	A	7: 4,947,342 (GRCm39)	L1232*	probably null	Het
Usp7	A	T	16: 8,514,518 (GRCm39)		probably benign	Het
Vmn2r51	T	G	7: 9,834,012 (GRCm39)	H342P	probably damaging	Het
Vmn2r70	A	G	7: 85,208,827 (GRCm39)	M550T	probably damaging	Het
Vmn2r81	T	C	10: 79,083,857 (GRCm39)		probably benign	Het
Zc3h13	T	C	14: 75,581,179 (GRCm39)	I1722T	possibly damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75,386,472 (GRCm39)	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75,381,232 (GRCm39)	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75,386,570 (GRCm39)	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75,390,818 (GRCm39)	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75,392,660 (GRCm39)	nonsense	probably null
IGL02077:Prpf8	APN	11	75,386,635 (GRCm39)	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75,381,498 (GRCm39)	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75,400,084 (GRCm39)	missense	probably benign	0.32
cutter	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
BB009:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75,387,181 (GRCm39)	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75,397,188 (GRCm39)	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75,396,075 (GRCm39)	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75,392,768 (GRCm39)	splice site	probably benign
R0573:Prpf8	UTSW	11	75,381,480 (GRCm39)	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75,394,270 (GRCm39)	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75,384,775 (GRCm39)	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75,399,500 (GRCm39)	unclassified	probably benign
R1123:Prpf8	UTSW	11	75,386,111 (GRCm39)	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75,386,249 (GRCm39)	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75,395,570 (GRCm39)	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75,387,337 (GRCm39)	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75,378,547 (GRCm39)	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75,381,357 (GRCm39)	missense	probably benign
R2185:Prpf8	UTSW	11	75,377,939 (GRCm39)	nonsense	probably null
R2271:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75,386,860 (GRCm39)	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75,397,547 (GRCm39)	splice site	probably null
R3893:Prpf8	UTSW	11	75,391,083 (GRCm39)	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75,381,528 (GRCm39)	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75,383,331 (GRCm39)	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75,400,054 (GRCm39)	splice site	probably null
R5186:Prpf8	UTSW	11	75,380,609 (GRCm39)	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75,391,030 (GRCm39)	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75,397,236 (GRCm39)	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75,399,784 (GRCm39)	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75,394,469 (GRCm39)	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75,394,464 (GRCm39)	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75,395,927 (GRCm39)	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75,395,564 (GRCm39)	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75,391,734 (GRCm39)	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75,400,015 (GRCm39)	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75,384,848 (GRCm39)	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75,384,334 (GRCm39)	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75,382,321 (GRCm39)	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
R6804:Prpf8	UTSW	11	75,390,635 (GRCm39)	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75,381,562 (GRCm39)	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75,395,654 (GRCm39)	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75,386,984 (GRCm39)	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75,399,374 (GRCm39)	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75,381,226 (GRCm39)	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75,394,181 (GRCm39)	nonsense	probably null
R7182:Prpf8	UTSW	11	75,381,553 (GRCm39)	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75,384,783 (GRCm39)	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75,382,610 (GRCm39)	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75,399,738 (GRCm39)	nonsense	probably null
R7522:Prpf8	UTSW	11	75,400,102 (GRCm39)	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75,399,200 (GRCm39)	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75,382,330 (GRCm39)	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75,391,022 (GRCm39)	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75,399,732 (GRCm39)	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75,385,300 (GRCm39)	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75,393,368 (GRCm39)	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75,390,976 (GRCm39)	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75,390,641 (GRCm39)	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75,382,600 (GRCm39)	nonsense	probably null
R8823:Prpf8	UTSW	11	75,384,282 (GRCm39)	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75,386,870 (GRCm39)	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75,380,589 (GRCm39)	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75,387,340 (GRCm39)	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75,397,212 (GRCm39)	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75,394,486 (GRCm39)	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75,385,608 (GRCm39)	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75,385,681 (GRCm39)	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75,394,257 (GRCm39)	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75,397,590 (GRCm39)	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75,394,160 (GRCm39)	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TGGGAGACTAACCTGACGTTCACC -3'
(R):5'- TCTGCCACCCACTAGATAATCTGCC -3'

Sequencing Primer
(F):5'- CAGGATGGGCCTTACATCACAG -3'
(R):5'- CACTAGATAATCTGCCAGGAATAAAG -3'

Posted On

2013-11-08