Incidental Mutation 'R3830:Gpat3'
ID273941
Institutional Source Beutler Lab
Gene Symbol Gpat3
Ensembl Gene ENSMUSG00000029314
Gene Nameglycerol-3-phosphate acyltransferase 3
SynonymsAgpat9, 4933407I02Rik, A230097K15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R3830 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100845713-100899102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100884386 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 183 (D183G)
Ref Sequence ENSEMBL: ENSMUSP00000108508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031255] [ENSMUST00000092990] [ENSMUST00000112887]
Predicted Effect probably benign
Transcript: ENSMUST00000031255
AA Change: D183G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031255
Gene: ENSMUSG00000029314
AA Change: D183G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Blast:PlsC 99 160 7e-6 BLAST
low complexity region 166 177 N/A INTRINSIC
PlsC 223 334 5.96e-22 SMART
Blast:PlsC 348 396 2e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000092990
AA Change: D183G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000090667
Gene: ENSMUSG00000029314
AA Change: D183G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Blast:PlsC 99 160 7e-6 BLAST
low complexity region 166 177 N/A INTRINSIC
PlsC 223 334 5.96e-22 SMART
Blast:PlsC 348 396 2e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112887
AA Change: D183G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000108508
Gene: ENSMUSG00000029314
AA Change: D183G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Blast:PlsC 99 160 7e-6 BLAST
low complexity region 166 177 N/A INTRINSIC
PlsC 223 334 5.96e-22 SMART
Blast:PlsC 348 396 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197115
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysophosphatidic acid acyltransferase protein family. The encoded protein is an enzyme which catalyzes the conversion of glycerol-3-phosphate to lysophosphatidic acid in the synthesis of triacylglycerol. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2012]
PHENOTYPE: Under high-fat feeding, mice homozygous for a knock-out allele exhibit increased energy expenditure, improved glucose homeostasis, enlarged livers, increased total serum cholesterol levels, altered liver cholesterol metabolism, and female-specific protection from diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agpat5 A G 8: 18,879,605 E250G probably benign Het
Aox4 A T 1: 58,255,511 T960S probably damaging Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Capn1 A T 19: 5,994,847 L465Q probably damaging Het
Cd300c A G 11: 114,959,627 F117L probably benign Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Cspg4 T G 9: 56,897,621 D1905E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Drd2 T A 9: 49,402,143 V204D probably damaging Het
Gclc A T 9: 77,791,960 I520L probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gprin3 T C 6: 59,353,633 E563G probably benign Het
Grm8 A T 6: 27,761,229 L332* probably null Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hecw1 C T 13: 14,346,058 S198N probably benign Het
Kcna2 T C 3: 107,104,796 I231T probably benign Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr222 G T 11: 59,571,601 N46K probably damaging Het
Pigb T C 9: 73,017,473 N468S probably benign Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Plekhg1 A G 10: 3,873,400 T123A probably damaging Het
Ptges3l T C 11: 101,421,617 *67W probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Six2 G T 17: 85,685,187 S296Y probably damaging Het
Slc5a12 T A 2: 110,632,736 C392* probably null Het
Snx5 A T 2: 144,254,901 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp729a A T 13: 67,619,878 F744Y probably damaging Het
Other mutations in Gpat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Gpat3 APN 5 100893144 missense probably benign 0.01
R1429:Gpat3 UTSW 5 100893087 missense probably damaging 0.99
R1539:Gpat3 UTSW 5 100883388 missense probably benign 0.00
R1830:Gpat3 UTSW 5 100893180 missense probably benign
R2030:Gpat3 UTSW 5 100897821 missense probably benign
R2440:Gpat3 UTSW 5 100857173 missense probably benign
R2444:Gpat3 UTSW 5 100857173 missense probably benign
R3039:Gpat3 UTSW 5 100897805 missense possibly damaging 0.75
R3813:Gpat3 UTSW 5 100891639 splice site probably benign
R4636:Gpat3 UTSW 5 100857173 missense probably benign
R4637:Gpat3 UTSW 5 100857173 missense probably benign
R4679:Gpat3 UTSW 5 100893456 missense probably damaging 1.00
R4792:Gpat3 UTSW 5 100857173 missense probably benign
R5229:Gpat3 UTSW 5 100883424 missense probably damaging 1.00
R5661:Gpat3 UTSW 5 100885942 nonsense probably null
R6383:Gpat3 UTSW 5 100893144 missense probably benign 0.01
R8064:Gpat3 UTSW 5 100891656 missense probably benign 0.36
X0023:Gpat3 UTSW 5 100885960 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTCAGCCCTGGCAAATTCAC -3'
(R):5'- TGCATAAACACTTCTAGTCTGAACC -3'

Sequencing Primer
(F):5'- CGCAATGCTCGACAAGGTG -3'
(R):5'- CACTTCTAGTCTGAACCAAAGTATG -3'
Posted On2015-04-02