Mutagenetix > Incidental Mutations

Incidental Mutation 'R1655:Top1'

189002

Institutional Source

Beutler Lab

Gene Symbol

Top1

Ensembl Gene

ENSMUSG00000070544

Gene Name

topoisomerase (DNA) I

Synonyms

D130064I21Rik, Top-1

MMRRC Submission

039691-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1655 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160645888-160722764 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 160703696 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109468]

Predicted Effect

probably null
Transcript: ENSMUST00000109468

SMART Domains

Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544

Domain	Start	End	E-Value	Type
low complexity region	20	95	N/A	INTRINSIC
low complexity region	150	211	N/A	INTRINSIC
Blast:TOPEUc	245	321	9e-19	BLAST
low complexity region	323	339	N/A	INTRINSIC
TOPEUc	362	739	4.43e-280	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164510

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	A	T	9: 51,083,621	I136N	probably damaging	Het
9530053A07Rik	A	T	7: 28,147,110	N1076Y	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,333		probably benign	Het
Abca1	C	T	4: 53,050,964	A1582T	probably benign	Het
Acot8	A	T	2: 164,803,108	S52T	probably benign	Het
Atcay	C	T	10: 81,213,397	V124M	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cfap46	A	T	7: 139,642,520	Y1180*	probably null	Het
Clptm1	T	A	7: 19,645,867	H148L	probably benign	Het
Clstn3	A	G	6: 124,437,427	L743P	probably damaging	Het
Crtc3	A	T	7: 80,598,776	M313K	possibly damaging	Het
Csgalnact1	T	A	8: 68,373,689	I326F	possibly damaging	Het
Dennd6b	G	T	15: 89,196,340	T19K	unknown	Het
Disp1	A	T	1: 183,087,004	I1284N	probably benign	Het
Dnah2	A	G	11: 69,473,854	Y1992H	probably damaging	Het
Dnah6	C	T	6: 73,205,732	V205I	possibly damaging	Het
Dst	G	T	1: 34,282,576	G4391*	probably null	Het
Dytn	A	G	1: 63,661,198	S258P	probably damaging	Het
Emilin3	T	A	2: 160,910,866		probably null	Het
Ermn	C	T	2: 58,052,584	V45I	probably benign	Het
Fat4	T	C	3: 38,957,318	V2189A	probably damaging	Het
Filip1l	T	C	16: 57,571,851	I934T	probably damaging	Het
Gbp9	T	A	5: 105,081,692	Q472L	possibly damaging	Het
Gimap5	G	T	6: 48,753,176	E227*	probably null	Het
Gsdmc	C	T	15: 63,780,043	V240M	probably benign	Het
H2-Q4	G	T	17: 35,382,905	V248F	probably damaging	Het
Helz2	T	C	2: 181,234,147	E1518G	probably damaging	Het
Hmcn1	A	G	1: 150,630,333	V3814A	probably benign	Het
Ifna7	A	G	4: 88,816,660	T145A	probably benign	Het
Itgam	T	A	7: 128,115,163	M947K	probably benign	Het
Itpr2	T	G	6: 146,376,148	N608H	probably damaging	Het
Klra2	T	A	6: 131,220,211	N242I	probably damaging	Het
Lonrf2	A	T	1: 38,811,824	L219Q	probably damaging	Het
Ly6c2	T	C	15: 75,108,563	I126V	probably benign	Het
Mr1	G	A	1: 155,132,455	T258M	probably benign	Het
Mrps35	T	G	6: 147,060,228	D200E	possibly damaging	Het
Nbeal2	A	C	9: 110,632,872	S1506A	probably damaging	Het
Ncoa7	T	C	10: 30,698,245		probably null	Het
Nlrp4a	A	T	7: 26,449,651	I228F	possibly damaging	Het
Olfr1047	A	G	2: 86,228,080	V297A	possibly damaging	Het
Olfr1339	A	G	4: 118,734,999	S157G	probably benign	Het
Olfr368	A	G	2: 37,331,939	Y64C	probably damaging	Het
Olfr483	A	T	7: 108,103,464	I52F	probably damaging	Het
Paxx	T	C	2: 25,460,316	E93G	probably damaging	Het
Per2	C	A	1: 91,448,768	G128W	probably damaging	Het
Piezo1	A	G	8: 122,496,822	I796T	probably benign	Het
Pkhd1	A	G	1: 20,584,129	S235P	probably damaging	Het
Pole	T	A	5: 110,335,922	F259Y	probably damaging	Het
Pus7	T	A	5: 23,747,800	K512*	probably null	Het
Ralyl	A	T	3: 14,107,236	Y55F	probably damaging	Het
Rgs14	T	A	13: 55,383,534	M451K	probably benign	Het
Rhag	T	C	17: 40,831,596	F231L	probably damaging	Het
Ric8a	T	C	7: 140,860,895	C94R	probably benign	Het
Rictor	T	A	15: 6,772,212	D460E	probably benign	Het
Rpn1	T	C	6: 88,100,944	V454A	possibly damaging	Het
Sacs	A	G	14: 61,191,782	D427G	probably benign	Het
Scai	A	T	2: 39,080,117	V545D	possibly damaging	Het
Serpinb3a	A	G	1: 107,046,212	V323A	probably damaging	Het
Slc13a5	C	A	11: 72,257,378	C277F	probably benign	Het
Slc15a1	A	T	14: 121,465,899	Y557N	probably benign	Het
Slc34a2	T	C	5: 53,069,419	V628A	probably benign	Het
Slc8a2	G	T	7: 16,141,135	G436V	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Supt5	T	C	7: 28,330,024	I103V	probably benign	Het
Tdrd1	T	A	19: 56,843,216	Y346*	probably null	Het
Tg	T	G	15: 66,828,568		probably null	Het
Trmt12	T	C	15: 58,873,227	L158P	probably damaging	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Unc80	G	T	1: 66,672,756	V2746F	possibly damaging	Het
Usp34	T	A	11: 23,375,051	V999E	probably benign	Het
Virma	T	C	4: 11,494,786	V29A	probably damaging	Het
Zfp40	A	T	17: 23,177,266	Y48N	probably benign	Het
Zfp609	A	G	9: 65,703,554	V709A	possibly damaging	Het

Other mutations in Top1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02168:Top1	APN	2	160704973	splice site	probably null
IGL03083:Top1	APN	2	160703578	missense	probably damaging	0.97
IGL03242:Top1	APN	2	160715733	missense	probably damaging	1.00
IGL03369:Top1	APN	2	160693727	missense	unknown
R0022:Top1	UTSW	2	160702799	missense	possibly damaging	0.62
R0449:Top1	UTSW	2	160712708	nonsense	probably null
R0501:Top1	UTSW	2	160714159	missense	probably damaging	1.00
R0564:Top1	UTSW	2	160714265	missense	probably damaging	0.98
R0946:Top1	UTSW	2	160712668	nonsense	probably null
R0972:Top1	UTSW	2	160721025	missense	probably damaging	1.00
R0976:Top1	UTSW	2	160717423	missense	possibly damaging	0.86
R1534:Top1	UTSW	2	160714232	missense	probably damaging	1.00
R1608:Top1	UTSW	2	160703595	missense	probably benign	0.01
R1818:Top1	UTSW	2	160715723	missense	probably damaging	1.00
R1937:Top1	UTSW	2	160670122	missense	unknown
R2055:Top1	UTSW	2	160702828	splice site	probably benign
R2104:Top1	UTSW	2	160704819	missense	probably damaging	1.00
R3705:Top1	UTSW	2	160702824	critical splice donor site	probably null
R3769:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3770:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3801:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3804:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3928:Top1	UTSW	2	160687749	splice site	probably benign
R4598:Top1	UTSW	2	160720965	missense	possibly damaging	0.89
R4651:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4652:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4742:Top1	UTSW	2	160703570	critical splice acceptor site	probably null
R5523:Top1	UTSW	2	160702775	nonsense	probably null
R6292:Top1	UTSW	2	160698141	missense	probably benign	0.19
R6724:Top1	UTSW	2	160712696	missense	probably damaging	1.00
R7354:Top1	UTSW	2	160704958	missense	probably damaging	1.00
X0027:Top1	UTSW	2	160721518	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGATGCCTTTACACAGGGTCAGTC -3'
(R):5'- AGATAGCTGCCAGTTAGCACAACAC -3'

Sequencing Primer
(F):5'- TTCACCATCCAAGGGCATTC -3'
(R):5'- CACTGTTGTGTCACAAGAAGC -3'

Posted On

2014-05-09