Incidental Mutation 'R3856:Cnst'
List |< first << previous [record 13 of 53] next >> last >|
ID276141
Institutional Source Beutler Lab
Gene Symbol Cnst
Ensembl Gene ENSMUSG00000038949
Gene Nameconsortin, connexin sorting protein
Synonyms
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location179546370-179627478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 179579714 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 109 (P109S)
Ref Sequence ENSEMBL: ENSMUSP00000048205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040706]
Predicted Effect probably benign
Transcript: ENSMUST00000040706
AA Change: P109S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949
AA Change: P109S

DomainStartEndE-ValueType
low complexity region 109 126 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
Pfam:Consortin_C 598 709 3.4e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153962
Meta Mutation Damage Score 0.1201 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]).[supplied by OMIM, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Cnst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Cnst APN 1 179624992 splice site probably benign
R0360:Cnst UTSW 1 179579535 missense probably benign 0.00
R1391:Cnst UTSW 1 179579486 missense possibly damaging 0.81
R1743:Cnst UTSW 1 179610392 missense probably benign 0.18
R1909:Cnst UTSW 1 179622791 missense probably damaging 1.00
R4565:Cnst UTSW 1 179604549 missense probably damaging 1.00
R5041:Cnst UTSW 1 179605028 missense probably damaging 0.99
R5072:Cnst UTSW 1 179622886 missense possibly damaging 0.61
R5087:Cnst UTSW 1 179622813 missense possibly damaging 0.82
R5294:Cnst UTSW 1 179610440 missense probably benign 0.03
R5349:Cnst UTSW 1 179622897 missense possibly damaging 0.58
R5394:Cnst UTSW 1 179601736 splice site probably benign
R6020:Cnst UTSW 1 179609875 missense probably benign
R6198:Cnst UTSW 1 179592865 missense probably damaging 1.00
R6669:Cnst UTSW 1 179605073 splice site probably null
R6767:Cnst UTSW 1 179609954 missense possibly damaging 0.92
R7007:Cnst UTSW 1 179610568 missense probably damaging 1.00
R7179:Cnst UTSW 1 179579382 start gained probably benign
R7356:Cnst UTSW 1 179606530 missense probably benign 0.01
R7730:Cnst UTSW 1 179625085 missense probably damaging 1.00
R7900:Cnst UTSW 1 179622888 missense probably damaging 1.00
R7983:Cnst UTSW 1 179622888 missense probably damaging 1.00
R8073:Cnst UTSW 1 179606437 missense probably benign 0.00
Z1088:Cnst UTSW 1 179579565 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATCAGCTTGCCGGAGAC -3'
(R):5'- ATTTCTCTATAGACCGTGACTGCAG -3'

Sequencing Primer
(F):5'- TGCGGGTCTGACCACCAG -3'
(R):5'- CTGCAGGGACAAATGGTATGC -3'
Posted On2015-04-06