Incidental Mutation 'R3838:Champ1'
ID276994
Institutional Source Beutler Lab
Gene Symbol Champ1
Ensembl Gene ENSMUSG00000047710
Gene Namechromosome alignment maintaining phosphoprotein 1
SynonymsZfp828, D8Ertd457e, D8Ertd569e
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13869641-13881639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13879939 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 699 (Y699C)
Ref Sequence ENSEMBL: ENSMUSP00000120117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033839] [ENSMUST00000051870] [ENSMUST00000128557]
Predicted Effect probably benign
Transcript: ENSMUST00000033839
SMART Domains Protein: ENSMUSP00000033839
Gene: ENSMUSG00000031458

DomainStartEndE-ValueType
Pfam:COPR5 24 173 1.3e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051870
AA Change: Y699C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057270
Gene: ENSMUSG00000047710
AA Change: Y699C

DomainStartEndE-ValueType
ZnF_C2H2 14 37 1.62e0 SMART
ZnF_C2H2 62 85 2.29e1 SMART
internal_repeat_1 109 278 1.19e-9 PROSPERO
low complexity region 298 318 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
internal_repeat_1 373 534 1.19e-9 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 677 690 N/A INTRINSIC
ZnF_C2H2 699 722 2.68e1 SMART
ZnF_C2H2 728 750 1.79e-2 SMART
ZnF_C2H2 755 776 2.23e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083883
Predicted Effect probably damaging
Transcript: ENSMUST00000128557
AA Change: Y699C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120117
Gene: ENSMUSG00000047710
AA Change: Y699C

DomainStartEndE-ValueType
ZnF_C2H2 14 37 1.62e0 SMART
ZnF_C2H2 62 85 2.29e1 SMART
internal_repeat_1 109 278 5.23e-7 PROSPERO
low complexity region 298 318 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
internal_repeat_1 373 534 5.23e-7 PROSPERO
low complexity region 602 613 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210249
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein that functions as a regulator of chromosome segregation in mitosis. The encoded protein is required for correct alignment of chromosomes on the metaphase plate, and plays a role in maintaining the attachment of sister kinetochores to microtubules from opposite spindle poles. Mutations in this gene are associated with autosomal dominant mental retardation-40. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Champ1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Champ1 APN 8 13879522 missense possibly damaging 0.68
IGL00775:Champ1 APN 8 13879509 missense probably damaging 1.00
IGL02451:Champ1 APN 8 13878739 missense probably damaging 1.00
IGL03283:Champ1 APN 8 13878786 missense probably benign 0.04
PIT4810001:Champ1 UTSW 8 13879234 missense probably benign 0.37
R0664:Champ1 UTSW 8 13879485 missense probably damaging 0.96
R2219:Champ1 UTSW 8 13880017 missense probably damaging 1.00
R3077:Champ1 UTSW 8 13878832 missense probably benign
R3735:Champ1 UTSW 8 13878735 missense probably damaging 1.00
R4714:Champ1 UTSW 8 13878063 missense probably damaging 1.00
R4933:Champ1 UTSW 8 13879137 missense probably benign 0.14
R5294:Champ1 UTSW 8 13878981 missense probably damaging 1.00
R5893:Champ1 UTSW 8 13878777 missense probably benign 0.08
R6548:Champ1 UTSW 8 13880002 missense probably damaging 1.00
R7261:Champ1 UTSW 8 13878517 missense possibly damaging 0.90
R7467:Champ1 UTSW 8 13878579 missense possibly damaging 0.89
R7747:Champ1 UTSW 8 13879990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTAGCAGTGAATACATCAGAGC -3'
(R):5'- TAAGTAAACTCTGCCCGTGGG -3'

Sequencing Primer
(F):5'- CAGATTTAGACACGTTGGACAC -3'
(R):5'- GCTGCTACGTGGTTTTTAAGAAGAG -3'
Posted On2015-04-06