Incidental Mutation 'R3838:Usp14'
ID277031
Institutional Source Beutler Lab
Gene Symbol Usp14
Ensembl Gene ENSMUSG00000047879
Gene Nameubiquitin specific peptidase 14
Synonyms2610005K12Rik, ataxia, NMF375, nmf375, dUB-type TGT, ax, 2610037B11Rik
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9995432-10045119 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 10024532 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092096] [ENSMUST00000116669]
Predicted Effect probably null
Transcript: ENSMUST00000092096
SMART Domains Protein: ENSMUSP00000089728
Gene: ENSMUSG00000047879

DomainStartEndE-ValueType
UBQ 4 74 3.61e-11 SMART
Pfam:UCH 104 479 9e-57 PFAM
Pfam:UCH_1 105 456 3.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116669
SMART Domains Protein: ENSMUSP00000112368
Gene: ENSMUSG00000047879

DomainStartEndE-ValueType
UBQ 4 73 2.63e-4 SMART
low complexity region 217 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150321
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. Mice with a mutation that results in reduced expression of the ortholog of this protein are retarded for growth, develop severe tremors by 2 to 3 weeks of age followed by hindlimb paralysis and death by 6 to 10 weeks of age. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic mutation develop severe tremors by 3 weeks of age, followed by hindlimb paralysis and premature death. An underdeveloped corpus callosum, hippocampus, dentate gyrus and forebrain structures, and notable defects in synaptic transmission in both the CNS and PNS are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Olfr959 A G 9: 39,572,971 V96A probably benign Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Usp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02671:Usp14 APN 18 9997196 missense probably damaging 0.99
IGL02756:Usp14 APN 18 10001769 critical splice donor site probably null
PIT4354001:Usp14 UTSW 18 9996189 missense probably damaging 1.00
R1238:Usp14 UTSW 18 9997763 missense probably benign
R1343:Usp14 UTSW 18 10016623 missense probably benign 0.03
R1365:Usp14 UTSW 18 10000490 splice site probably null
R1495:Usp14 UTSW 18 10004994 missense probably benign 0.01
R1817:Usp14 UTSW 18 10024673 missense probably damaging 1.00
R2021:Usp14 UTSW 18 10024632 missense probably damaging 0.99
R2190:Usp14 UTSW 18 10007835 missense probably damaging 1.00
R3836:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3837:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3839:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3870:Usp14 UTSW 18 10002370 missense possibly damaging 0.89
R3871:Usp14 UTSW 18 10002370 missense possibly damaging 0.89
R5388:Usp14 UTSW 18 10018023 missense probably damaging 1.00
R5767:Usp14 UTSW 18 10009935 intron probably benign
R5871:Usp14 UTSW 18 9996234 missense probably benign 0.27
R5898:Usp14 UTSW 18 10022819 missense possibly damaging 0.62
R7899:Usp14 UTSW 18 10000563 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGACATGATGCTCCTCACATAC -3'
(R):5'- GGCTCTGAAACATGACGTTGG -3'

Sequencing Primer
(F):5'- AACATCACTAGAACAGTTTAAATGGG -3'
(R):5'- CTGCTGGCTTTGAACTCACAAAAG -3'
Posted On2015-04-06