Incidental Mutation 'R3838:Olfr959'
ID276996
Institutional Source Beutler Lab
Gene Symbol Olfr959
Ensembl Gene ENSMUSG00000059366
Gene Nameolfactory receptor 959
SynonymsGA_x6K02T2PVTD-33270211-33269276, MOR224-3
MMRRC Submission 040779-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3838 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39569383-39575569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39572971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 96 (V96A)
Ref Sequence ENSEMBL: ENSMUSP00000150349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079178] [ENSMUST00000215194] [ENSMUST00000216298]
Predicted Effect probably benign
Transcript: ENSMUST00000079178
AA Change: V96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078176
Gene: ENSMUSG00000059366
AA Change: V96A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 33 251 1.2e-7 PFAM
Pfam:7tm_1 39 286 2.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215194
AA Change: V96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216298
AA Change: V96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik A G 4: 116,173,521 T41A probably benign Het
4930486L24Rik A G 13: 60,845,227 Y213H probably damaging Het
Alg8 C T 7: 97,388,545 H379Y probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Arid4a A G 12: 71,075,785 E980G possibly damaging Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
Bud13 A C 9: 46,290,192 Q387P possibly damaging Het
Champ1 A G 8: 13,879,939 Y699C probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Col2a1 T C 15: 97,988,976 D345G unknown Het
Col2a1 A T 15: 98,000,581 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Dnajb2 G A 1: 75,241,480 probably null Het
Dock4 G T 12: 40,794,624 probably null Het
Epx A T 11: 87,874,830 L101Q probably damaging Het
F13a1 A T 13: 37,047,424 N21K probably damaging Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a T C 14: 34,245,368 D77G probably benign Het
Foxj3 T A 4: 119,616,624 H215Q possibly damaging Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Ighmbp2 T C 19: 3,271,658 Y367C probably benign Het
Lrrc14b A G 13: 74,363,545 C139R possibly damaging Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Myh7b A G 2: 155,632,989 K1816E probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nme2 T A 11: 93,949,977 E252D probably benign Het
Ntpcr G A 8: 125,737,372 V79M probably damaging Het
Ogdh C T 11: 6,338,627 R235* probably null Het
Olfr1490 A G 19: 13,654,957 D176G probably benign Het
Olfr825 C A 10: 130,162,406 E307* probably null Het
Pcdh20 T C 14: 88,468,463 N467S probably benign Het
Pkhd1 G A 1: 20,534,629 T1154I possibly damaging Het
Polq G T 16: 37,078,349 R2157I probably damaging Het
Reep6 C A 10: 80,335,889 A533E probably damaging Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Sept11 T A 5: 93,148,399 I52N probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Spdye4b C T 5: 143,192,329 T11I probably benign Het
Srrt C T 5: 137,302,125 probably null Het
Sspo T A 6: 48,480,820 C3085S probably damaging Het
Stim1 C T 7: 102,411,296 T182I possibly damaging Het
Thbs2 C A 17: 14,687,851 V217L probably benign Het
Thpo G A 16: 20,728,748 R38C probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Trim12c T A 7: 104,340,868 probably benign Het
Tvp23b A G 11: 62,883,629 H33R possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r73 A G 7: 85,858,050 W685R probably benign Het
Zfp618 G A 4: 63,133,564 A861T probably benign Het
Zfp715 A G 7: 43,299,756 V260A probably benign Het
Other mutations in Olfr959
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02825:Olfr959 APN 9 39572581 missense probably damaging 0.97
R0122:Olfr959 UTSW 9 39572724 missense probably damaging 1.00
R0483:Olfr959 UTSW 9 39572843 missense probably damaging 1.00
R1843:Olfr959 UTSW 9 39572735 missense possibly damaging 0.74
R2038:Olfr959 UTSW 9 39572987 missense probably damaging 1.00
R4801:Olfr959 UTSW 9 39572858 missense probably benign 0.00
R4802:Olfr959 UTSW 9 39572858 missense probably benign 0.00
R4839:Olfr959 UTSW 9 39573145 missense probably benign
R4967:Olfr959 UTSW 9 39572758 missense probably damaging 1.00
R6128:Olfr959 UTSW 9 39573253 missense probably benign 0.00
R6196:Olfr959 UTSW 9 39572480 missense possibly damaging 0.75
R6551:Olfr959 UTSW 9 39572560 missense probably benign 0.00
R7757:Olfr959 UTSW 9 39572465 missense probably benign 0.02
R7892:Olfr959 UTSW 9 39572549 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAAAGTAGCCTGAATGCAGCC -3'
(R):5'- GGAAACTATGCTCTTTGTCCTG -3'

Sequencing Primer
(F):5'- AGTAGCGTAATGGGTAGC -3'
(R):5'- CTACATCTTCACTCTGATGGGAAAC -3'
Posted On2015-04-06