Incidental Mutation 'R1843:Or10d1'
ID 207444
Institutional Source Beutler Lab
Gene Symbol Or10d1
Ensembl Gene ENSMUSG00000059366
Gene Name olfactory receptor family 10 subfamily D member 1
Synonyms MOR224-3, GA_x6K02T2PVTD-33270211-33269276, Olfr959
MMRRC Submission 039868-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R1843 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 39483618-39484553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39484031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 175 (Y175H)
Ref Sequence ENSEMBL: ENSMUSP00000150349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079178] [ENSMUST00000215194] [ENSMUST00000216298]
AlphaFold Q9EQ86
Predicted Effect possibly damaging
Transcript: ENSMUST00000079178
AA Change: Y175H

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078176
Gene: ENSMUSG00000059366
AA Change: Y175H

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 33 251 1.2e-7 PFAM
Pfam:7tm_1 39 286 2.7e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215194
AA Change: Y175H

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216298
AA Change: Y175H

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik C T 8: 106,435,606 (GRCm39) T88M probably damaging Het
9430038I01Rik A G 7: 136,978,795 (GRCm39) probably benign Het
Adgra3 A C 5: 50,118,834 (GRCm39) S905A probably damaging Het
Adgrv1 A G 13: 81,692,652 (GRCm39) Y1618H probably damaging Het
Anapc15-ps T C 10: 95,509,176 (GRCm39) T26A probably benign Het
Ankrd13d T C 19: 4,321,623 (GRCm39) K360E probably damaging Het
Anks1b T A 10: 90,348,751 (GRCm39) probably null Het
Apob T C 12: 8,057,602 (GRCm39) F2028S possibly damaging Het
Arap3 G A 18: 38,108,636 (GRCm39) R1265W probably damaging Het
Arhgef37 A G 18: 61,651,121 (GRCm39) Y135H probably damaging Het
Armh3 A C 19: 45,963,691 (GRCm39) S42R probably benign Het
Atp1a1 T C 3: 101,489,333 (GRCm39) T760A probably benign Het
Cdc42bpb T A 12: 111,289,255 (GRCm39) M497L probably benign Het
Ces5a C T 8: 94,240,859 (GRCm39) V413M probably damaging Het
Chd5 A T 4: 152,470,263 (GRCm39) Y1903F probably damaging Het
Chd9 T A 8: 91,737,422 (GRCm39) N1500K probably benign Het
Chmp7 G T 14: 69,957,248 (GRCm39) D303E probably benign Het
Chrnb4 A T 9: 54,942,102 (GRCm39) Y391N possibly damaging Het
Crtc1 T C 8: 70,840,802 (GRCm39) T475A probably benign Het
Cyp2c69 A G 19: 39,865,972 (GRCm39) I207T probably benign Het
Dcp1a A G 14: 30,240,940 (GRCm39) E250G probably damaging Het
Ddx20 T C 3: 105,586,398 (GRCm39) Q649R probably benign Het
Defb12 T A 8: 19,162,754 (GRCm39) K59N probably damaging Het
Dpy19l3 A T 7: 35,429,185 (GRCm39) I85N probably damaging Het
Duox2 C T 2: 122,122,739 (GRCm39) probably null Het
Ebi3 T A 17: 56,263,679 (GRCm39) Y197N probably damaging Het
Emc1 G A 4: 139,102,823 (GRCm39) R994Q probably benign Het
Ercc6 G T 14: 32,268,777 (GRCm39) M530I probably damaging Het
Evl T A 12: 108,619,255 (GRCm39) D70E probably damaging Het
Fbln2 A G 6: 91,242,757 (GRCm39) N819S probably damaging Het
Foxk2 A G 11: 121,176,363 (GRCm39) I170V probably benign Het
Gfm1 T C 3: 67,342,943 (GRCm39) V159A probably damaging Het
Gm10837 A G 14: 122,728,177 (GRCm39) T18A unknown Het
Gm12887 A T 4: 121,479,227 (GRCm39) V25E probably damaging Het
Hectd4 A G 5: 121,435,243 (GRCm39) H985R possibly damaging Het
Hsfy2 A G 1: 56,675,791 (GRCm39) Y249H possibly damaging Het
Hspg2 T C 4: 137,272,878 (GRCm39) V2639A probably damaging Het
Igf2r A G 17: 12,923,157 (GRCm39) probably null Het
Invs T A 4: 48,422,035 (GRCm39) I889N probably damaging Het
Kcnq1 A T 7: 142,736,857 (GRCm39) M209L probably benign Het
Klra7 A G 6: 130,206,957 (GRCm39) I48T possibly damaging Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrif1 T A 3: 106,640,127 (GRCm39) V404D probably damaging Het
Lrriq1 T A 10: 103,063,034 (GRCm39) probably null Het
Lypd6 T A 2: 50,078,774 (GRCm39) I90N possibly damaging Het
Mbp A G 18: 82,602,247 (GRCm39) D174G probably damaging Het
Megf9 G T 4: 70,453,022 (GRCm39) P13Q probably damaging Het
Myo15b A T 11: 115,760,412 (GRCm39) T1155S probably benign Het
Nherf2 C T 17: 24,860,693 (GRCm39) S150N possibly damaging Het
Nlrp6 T A 7: 140,503,006 (GRCm39) C371S probably damaging Het
Nosip T A 7: 44,726,733 (GRCm39) probably null Het
Nox3 G T 17: 3,720,153 (GRCm39) P344H probably damaging Het
Nup210l T C 3: 90,079,393 (GRCm39) V959A probably damaging Het
Or2b2b C A 13: 21,858,842 (GRCm39) V91L probably benign Het
Or2k2 T C 4: 58,785,384 (GRCm39) I113V probably benign Het
Or5b119 A G 19: 13,457,295 (GRCm39) I89T probably benign Het
Or5k8 T A 16: 58,644,440 (GRCm39) I211F probably damaging Het
Osbpl3 A C 6: 50,347,123 (GRCm39) S25A probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Pax7 G A 4: 139,511,802 (GRCm39) R260C probably damaging Het
Pbrm1 A T 14: 30,760,914 (GRCm39) I224F probably damaging Het
Pcdh1 T A 18: 38,325,278 (GRCm39) probably null Het
Pcnx1 T C 12: 82,027,709 (GRCm39) L1585P probably damaging Het
Pde4c C T 8: 71,200,599 (GRCm39) H362Y probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pgm1 A T 4: 99,818,675 (GRCm39) Q90L probably damaging Het
Phlpp1 A G 1: 106,271,235 (GRCm39) H814R probably benign Het
Pknox2 A T 9: 36,866,127 (GRCm39) M5K possibly damaging Het
Pole G A 5: 110,478,701 (GRCm39) probably null Het
Polr1b A G 2: 128,944,886 (GRCm39) I61V probably benign Het
Prelp T C 1: 133,842,495 (GRCm39) K217E probably damaging Het
Prkce C T 17: 86,782,974 (GRCm39) Q202* probably null Het
Psmd2 T G 16: 20,475,332 (GRCm39) M370R probably benign Het
Rimklb A T 6: 122,440,968 (GRCm39) H68Q probably damaging Het
Rnasel A G 1: 153,630,420 (GRCm39) D312G possibly damaging Het
Rxrg A T 1: 167,426,321 (GRCm39) M1L probably benign Het
Scrn1 A G 6: 54,499,826 (GRCm39) F220L possibly damaging Het
Scyl3 A G 1: 163,778,244 (GRCm39) S461G probably benign Het
Serpina1c T A 12: 103,861,282 (GRCm39) T411S probably benign Het
Serpinb6d C T 13: 33,855,364 (GRCm39) P346L probably benign Het
Shld2 A G 14: 33,989,760 (GRCm39) I382T probably benign Het
Spg21 G T 9: 65,372,618 (GRCm39) V17F probably damaging Het
Spink5 A T 18: 44,132,958 (GRCm39) M525L probably benign Het
Sun2 T C 15: 79,621,764 (GRCm39) T155A probably benign Het
Tchh T A 3: 93,354,087 (GRCm39) F1176I unknown Het
Tex15 T A 8: 34,066,682 (GRCm39) D2037E probably benign Het
Tfdp2 T C 9: 96,199,857 (GRCm39) C392R possibly damaging Het
Tmem30c T C 16: 57,097,143 (GRCm39) N139S probably benign Het
Tns2 C T 15: 102,021,568 (GRCm39) probably null Het
Trim66 T C 7: 109,075,046 (GRCm39) E405G probably damaging Het
Trpc4 T A 3: 54,187,415 (GRCm39) F456I probably benign Het
Tspo2 T C 17: 48,755,818 (GRCm39) D108G possibly damaging Het
Tyk2 A T 9: 21,032,850 (GRCm39) C304* probably null Het
Vgll4 A T 6: 114,839,756 (GRCm39) S185T probably benign Het
Vmn2r94 A C 17: 18,464,732 (GRCm39) S519R probably benign Het
Vmn2r96 T G 17: 18,818,183 (GRCm39) S587A probably benign Het
Vps4b C A 1: 106,706,712 (GRCm39) A287S possibly damaging Het
Yeats2 C T 16: 20,048,314 (GRCm39) P1332S probably benign Het
Zfp462 T G 4: 55,010,010 (GRCm39) S659A possibly damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp764l1 A C 7: 126,990,660 (GRCm39) D442E probably benign Het
Zswim5 G T 4: 116,734,896 (GRCm39) E80D unknown Het
Other mutations in Or10d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02825:Or10d1 APN 9 39,483,877 (GRCm39) missense probably damaging 0.97
R0122:Or10d1 UTSW 9 39,484,020 (GRCm39) missense probably damaging 1.00
R0483:Or10d1 UTSW 9 39,484,139 (GRCm39) missense probably damaging 1.00
R2038:Or10d1 UTSW 9 39,484,283 (GRCm39) missense probably damaging 1.00
R3838:Or10d1 UTSW 9 39,484,267 (GRCm39) missense probably benign
R4801:Or10d1 UTSW 9 39,484,154 (GRCm39) missense probably benign 0.00
R4802:Or10d1 UTSW 9 39,484,154 (GRCm39) missense probably benign 0.00
R4839:Or10d1 UTSW 9 39,484,441 (GRCm39) missense probably benign
R4967:Or10d1 UTSW 9 39,484,054 (GRCm39) missense probably damaging 1.00
R6128:Or10d1 UTSW 9 39,484,549 (GRCm39) missense probably benign 0.00
R6196:Or10d1 UTSW 9 39,483,776 (GRCm39) missense possibly damaging 0.75
R6551:Or10d1 UTSW 9 39,483,856 (GRCm39) missense probably benign 0.00
R7757:Or10d1 UTSW 9 39,483,761 (GRCm39) missense probably benign 0.02
R7892:Or10d1 UTSW 9 39,483,845 (GRCm39) missense possibly damaging 0.96
R8674:Or10d1 UTSW 9 39,484,249 (GRCm39) missense probably damaging 1.00
R8693:Or10d1 UTSW 9 39,483,800 (GRCm39) missense probably damaging 1.00
R8958:Or10d1 UTSW 9 39,484,091 (GRCm39) missense probably benign 0.00
R9101:Or10d1 UTSW 9 39,483,805 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGGACAACTGGCATGTAG -3'
(R):5'- GCATATGACCGTTTTGTGGC -3'

Sequencing Primer
(F):5'- AGAAGGCTCTACGACGGC -3'
(R):5'- GTGGCCATATGCTACCCATTACG -3'
Posted On 2014-06-23