Incidental Mutation 'R3840:Lrrc4c'
ID277097
Institutional Source Beutler Lab
Gene Symbol Lrrc4c
Ensembl Gene ENSMUSG00000050587
Gene Nameleucine rich repeat containing 4C
Synonymsnetrin g1 ligand, 6430556C10Rik
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location96318169-97631666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97630192 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 388 (T388A)
Ref Sequence ENSEMBL: ENSMUSP00000125218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059049] [ENSMUST00000135431] [ENSMUST00000162807] [ENSMUST00000170144]
Predicted Effect probably damaging
Transcript: ENSMUST00000059049
AA Change: T388A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131795
Gene: ENSMUSG00000050587
AA Change: T388A

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135431
AA Change: T388A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130984
Gene: ENSMUSG00000050587
AA Change: T388A

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162807
AA Change: T388A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125218
Gene: ENSMUSG00000050587
AA Change: T388A

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
LRRNT 46 80 6.95e-4 SMART
LRR 79 98 1.97e2 SMART
LRR_TYP 99 122 7.37e-4 SMART
LRR 123 146 1.08e-1 SMART
LRR_TYP 147 170 1.38e-3 SMART
Blast:LRR 171 195 5e-8 BLAST
LRR 196 217 8.03e1 SMART
LRR_TYP 218 241 2.12e-4 SMART
LRR 242 265 6.97e1 SMART
LRR_TYP 266 289 2.53e-2 SMART
LRRCT 301 352 2.68e-2 SMART
IGc2 366 433 1.22e-7 SMART
transmembrane domain 526 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199276
Meta Mutation Damage Score 0.1185 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NGL1 is a specific binding partner for netrin G1 (NTNG1; MIM 608818), which is a member of the netrin family of axon guidance molecules (Lin et al., 2003 [PubMed 14595443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice exhibited an increased mean serum IL-6 response to LPS challenge when compared with controls. No other notable phenotype was detected in a high-througput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Lrrc4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Lrrc4c APN 2 97630385 nonsense probably null
IGL02095:Lrrc4c APN 2 97629404 missense probably benign 0.05
IGL02165:Lrrc4c APN 2 97629033 start codon destroyed probably null 0.33
IGL02176:Lrrc4c APN 2 97630253 missense probably damaging 0.96
IGL02674:Lrrc4c APN 2 97629775 missense probably damaging 0.99
IGL03082:Lrrc4c APN 2 97630586 missense probably benign 0.05
IGL03303:Lrrc4c APN 2 97629592 missense probably damaging 1.00
R0946:Lrrc4c UTSW 2 97629464 missense probably benign 0.00
R1037:Lrrc4c UTSW 2 97629985 missense probably benign
R1518:Lrrc4c UTSW 2 97630576 missense probably benign
R1559:Lrrc4c UTSW 2 97630772 missense probably benign 0.00
R2192:Lrrc4c UTSW 2 97629312 missense possibly damaging 0.50
R2213:Lrrc4c UTSW 2 97630471 missense probably benign 0.29
R2279:Lrrc4c UTSW 2 97630505 missense possibly damaging 0.86
R3552:Lrrc4c UTSW 2 97629961 missense probably damaging 1.00
R3841:Lrrc4c UTSW 2 97630192 missense probably damaging 0.98
R4606:Lrrc4c UTSW 2 97630313 missense probably benign 0.22
R4938:Lrrc4c UTSW 2 97629301 missense probably damaging 1.00
R4946:Lrrc4c UTSW 2 97630489 missense probably benign 0.00
R5323:Lrrc4c UTSW 2 97630153 missense probably damaging 1.00
R6014:Lrrc4c UTSW 2 97629212 splice site probably null
R6297:Lrrc4c UTSW 2 97629619 missense probably damaging 0.99
R6376:Lrrc4c UTSW 2 97629046 missense probably benign 0.03
R7032:Lrrc4c UTSW 2 97629065 missense probably benign
R7419:Lrrc4c UTSW 2 97629761 missense probably benign 0.07
R7699:Lrrc4c UTSW 2 97630679 missense possibly damaging 0.81
R7700:Lrrc4c UTSW 2 97630679 missense possibly damaging 0.81
R7723:Lrrc4c UTSW 2 97630654 missense possibly damaging 0.91
R7736:Lrrc4c UTSW 2 97630360 missense probably benign 0.02
R7843:Lrrc4c UTSW 2 97630213 missense probably benign 0.19
R7880:Lrrc4c UTSW 2 97630798 missense probably benign 0.08
R8008:Lrrc4c UTSW 2 97630249 missense possibly damaging 0.88
R8479:Lrrc4c UTSW 2 97629632 missense probably damaging 1.00
R8802:Lrrc4c UTSW 2 97630258 missense possibly damaging 0.83
R8821:Lrrc4c UTSW 2 97629695 missense possibly damaging 0.88
R8906:Lrrc4c UTSW 2 97630048 missense probably benign 0.00
R8933:Lrrc4c UTSW 2 97629481 missense probably benign 0.36
Z1177:Lrrc4c UTSW 2 97630483 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCTCAGCTGGTGGATAAG -3'
(R):5'- TAACATTCAAGGTGGCAGAAGC -3'

Sequencing Primer
(F):5'- TGTGCCAGGTGTAACACTC -3'
(R):5'- CAGAAGCAGTGGTGTTGCC -3'
Posted On2015-04-06