Incidental Mutation 'R3845:Slc5a4a'
ID277333
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Namesolute carrier family 5, member 4a
Synonyms
MMRRC Submission 040893-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3845 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76147451-76189265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76189149 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 620 (E620G)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
Predicted Effect probably damaging
Transcript: ENSMUST00000020450
AA Change: E620G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: E620G

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apool A T X: 112,364,458 probably benign Het
Atp4a A G 7: 30,717,115 N439S probably null Het
AU041133 T A 10: 82,151,318 H268Q probably damaging Het
Ccdc105 T C 10: 78,748,698 N330S probably benign Het
Ccdc136 C T 6: 29,417,177 R666W probably benign Het
Ccdc97 T C 7: 25,715,028 probably benign Het
Celf1 T C 2: 91,009,238 V336A possibly damaging Het
Chd3 T C 11: 69,346,759 N1870D possibly damaging Het
Col5a3 C T 9: 20,808,377 D229N unknown Het
Cpn1 G T 19: 43,974,084 P142Q possibly damaging Het
Cubn T C 2: 13,283,008 D3420G probably damaging Het
Cyp2u1 A G 3: 131,293,486 F482S possibly damaging Het
Foxo1 T A 3: 52,346,280 D621E probably benign Het
Gm13084 T C 4: 143,811,975 E142G probably damaging Het
Gm5346 T C 8: 43,626,632 N185S probably benign Het
Grid2 A G 6: 64,345,842 M609V possibly damaging Het
Hsd17b3 A T 13: 64,089,062 F23I possibly damaging Het
Kcnk10 A G 12: 98,440,744 I217T probably benign Het
Mis18bp1 G A 12: 65,149,142 S616L possibly damaging Het
Mtch1 A T 17: 29,342,832 F133I probably damaging Het
Myh4 T A 11: 67,259,105 V1830E possibly damaging Het
Nav3 T C 10: 109,853,376 M347V possibly damaging Het
Nbea A G 3: 56,086,292 probably benign Het
Nhej1 A T 1: 74,968,883 D76E probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1024 A C 2: 85,904,737 C106G probably damaging Het
Papd5 A T 8: 88,250,664 I322F possibly damaging Het
Pias3 T C 3: 96,702,210 V307A probably benign Het
Pltp T A 2: 164,854,288 M135L probably benign Het
Plxna2 A G 1: 194,793,790 Y1106C probably damaging Het
Ptgir G A 7: 16,907,386 R201H probably damaging Het
Ptk7 A T 17: 46,586,418 D329E probably benign Het
Pygl T C 12: 70,198,443 D411G probably benign Het
Rev1 A T 1: 38,098,988 M72K probably damaging Het
Sfrp1 T C 8: 23,412,248 L155P probably damaging Het
Smarca2 A G 19: 26,720,873 I1314V probably benign Het
Tas2r109 G A 6: 132,980,803 L55F probably damaging Het
Tek T A 4: 94,804,872 C274S probably damaging Het
Tmem38b T A 4: 53,859,905 D228E probably benign Het
Topbp1 T C 9: 103,309,923 V109A possibly damaging Het
Trbv5 A G 6: 41,062,748 I96V probably benign Het
Trim16 T G 11: 62,836,672 probably benign Het
Upf3a A T 8: 13,798,238 T345S probably benign Het
Usp15 A G 10: 123,119,135 S913P probably damaging Het
Vmn2r124 T A 17: 18,073,691 V680D possibly damaging Het
Vmn2r91 G A 17: 18,107,598 V485I probably benign Het
Zdbf2 A T 1: 63,308,324 H1954L possibly damaging Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 unclassified probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 76147667 critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 76147550 missense unknown
Z1177:Slc5a4a UTSW 10 76166744 missense probably benign 0.01
Z1177:Slc5a4a UTSW 10 76182847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATACTTCCTCATGATCCTTCTGG -3'
(R):5'- ACCAATTGCTAATGGCCTCC -3'

Sequencing Primer
(F):5'- GATCCTTCTGGCTCTTGTAAAAATTG -3'
(R):5'- CAATTGCTAATGGCCTCCTGTAAG -3'
Posted On2015-04-06